# LabCanvas > LabCanvas is a browser-based workspace for scientific visuals. It combines a vector figure editor, a presentation maker, a research poster designer, a 3D studio, a protein structure viewer and a graphing and statistics app, with journal-ready export and an AI assistant. The apps are free to use with an account (up to 3 designs, no downloads); LabCanvas Pro (US$19 a month or US$199 a year) adds downloads in every format, unlimited designs and monthly AI credits. The website and the free tools at /tools need no account. Designs are kept in the user's browser and, optionally, in the user's private cloud folder. LabCanvas runs entirely in the web browser. Its apps share one design library and clipboard, can be installed as desktop apps, and can be driven by AI models: through a built-in assistant (Claude and other leading models, with monthly AI credits) or through an MCP server with 109 tools. ## Apps - [Figure editor](https://www.labcanvas.com/editor.html): Illustrator-level vector tools made for scientific figures. Pen, Pathfinder, gradients and scientific brushes (DNA, membranes, proteins); 500+ adjustable science objects, lab glassware and instruments, any molecule from PubChem in 3D, plus LaTeX equations and tables; TIFF, PDF, SVG and PNG at the DPI and column width your journal asks for. - [Slides](https://www.labcanvas.com/slides.html): Presentations built on the same editor, with real vector figures. PowerPoint-style slide strip, layouts and themes; Fade, push, wipe, zoom, flip and more transitions; Speaker notes, full-screen presenting and one vector PDF. - [Research Poster](https://www.labcanvas.com/poster.html): Research posters from blocks that stack in columns and re-flow their text. Drag blocks between columns: the poster re-arranges itself; resize and text re-flows; Title, figure, key finding, big number, references and QR code blocks with themes; A0, A1 and 48 × 36 in templates, exported as a print-ready vector PDF. - [MolDraw](https://www.labcanvas.com/moldraw/): Chemical structures: draw molecules and reactions, then turn them in 3D. Atoms, bonds, rings, charges and reaction arrows, with ring and group templates; Structures from PubChem to start from; A 3D view of the same molecule. - [3D Studio](https://www.labcanvas.com/studio3d.html): Procedural nanomaterials, devices and molecules with ray-traced renders. Nanoparticles, porous scaffolds, MOFs, 2D materials, solar cells, batteries; Molecules from PubChem and proteins from the RCSB PDB; Every model has sliders; renders drop straight into your figure. - [Protein viewer](https://www.labcanvas.com/protein.html): A fast, focused viewer for PDB structures, powered by Miew. Load any PDB ID or your own PDB / mmCIF file; Select residues on the sequence and restyle them; Cartoon, surfaces, ball-and-stick; transparent PNG snapshots. - [Graphs & statistics](https://www.labcanvas.com/plot.html): Prism-style data tables, graphs and statistics. Column, XY, grouped, survival and contingency tables; t tests, ANOVA with post-hoc tests, curve fits, log-rank; Results checked against SciPy and statsmodels. - [Image Analysis](https://www.labcanvas.com/analysis.html): Measure microscope images, western blots and gels on their raw values, with guided assays. Guided assays: nuclear translocation, spots per cell, wound healing, FRAP, calcium, tracking, branching; Blots with a molecular-weight ladder, counting by threshold or a classifier trained with a few brush strokes; ImageJ definitions, checked in more than 4,000 tests against scikit-image and SciPy; results go to Graphs. - [Optics](https://www.labcanvas.com/optics.html): Optical setups on a breadboard, with the beam path simulated live. Lasers and lamps, lenses, mirrors, prisms, gratings, beam splitters and detectors; Rays traced live as you move parts on the breadboard; Clean schematics to export into a figure. - [Pixel editor](https://www.labcanvas.com/editor.html?mode=pixel): Microscopy and photo touch-ups without leaving your figure. Crop, levels, exposure and false-colour lookup tables; Healing, clone stamp, selections and masks; Edits flow back into the figure layer. ## Main workflows - **Illustrate in 2D** ([figure editor](https://www.labcanvas.com/editor.html)): Draw figures and graphical abstracts with vector shapes, the pen and scientific brushes for DNA, membranes and proteins. Add any of 500+ science objects and change every detail with a setting. - **Illustrate in 3D** ([3D Studio](https://www.labcanvas.com/studio3d.html)): Build nanomaterials, crystals and devices in the 3D Studio, or bring in molecules from PubChem and proteins from the PDB. Render them ray traced and drop the image into your figure. - **Graphs** ([Graphs](https://www.labcanvas.com/plot.html)): Type or paste your data into tables, run t tests, ANOVA and curve fits, and make publication graphs with significance brackets. The results are checked against SciPy and statsmodels. - **Edit images** ([Pixel workspace](https://www.labcanvas.com/editor.html?mode=pixel)): Crop micrographs and photos, set levels and curves, and retouch dust or scratches in the Pixel workspace, right on your figure, without a separate image editor. - **Present or publish** ([Slides](https://www.labcanvas.com/slides.html), [Research Poster](https://www.labcanvas.com/poster.html)): Put your figures on slides with transitions, or lay them out on a research poster that re-flows as you edit. When you submit, export TIFF, PDF, PNG or SVG at the width and resolution the journal asks for. ## Key facts - **Journal-ready export**: Set the width in millimetres and the resolution (300, 600 or 1200 dpi) and export TIFF, PDF, SVG, PNG, JPEG or WebP. Files carry their DPI, so the size is right when the journal opens them. - **500+ science objects**: Liposomes, cancer cells, viruses, nanoparticles, crystals, hydrogels, devices and lab instruments: drawn by generators, so every detail is a setting. - **LaTeX and tables**: Equations typeset by MathJax into vector outlines, and editable tables with scientific (booktabs) styles. - **Lab glassware that connects**: Flasks, condensers, still heads, adapters, funnels, burettes, stands, hot plates, furnaces and gloveboxes at real proportions. Pieces snap onto each other’s joints and tubing follows them, so a distillation setup stays assembled as you move it. - **Molecules and proteins**: Import compounds from PubChem and structures from the RCSB PDB; show them as cartoons, surfaces or ball-and-stick. - **Statistics you can check**: Prism-style analyses whose results are validated against SciPy, statsmodels, lifelines and R in more than 42,000 automated checks. - **Posters that arrange themselves**: Drag a block between two others or into another column and the poster re-stacks; resize it and the text re-flows. A0 and 48 × 36 in templates, themes, QR codes and a print-ready vector PDF. - **Private by default**: Designs autosave in your browser and, if you choose, to your own private cloud folder so you can open them on any computer. Nothing is public, and nobody else can open your work. ## Figure templates 192 editable scientific figure templates (graphical abstracts) for chemistry and materials science, each citing the papers it follows: https://www.labcanvas.com/templates. Every template page has a Markdown version at the same address with .md added. ### Multipanel figures - [Four-panel figure (2 × 2)](https://www.labcanvas.com/templates/multipanel/four-panel-figure-2-2): The most common journal figure: four equal panels a–d on one grid, with a schematic, an image and two graphs. - [One large panel and three small (1 + 3)](https://www.labcanvas.com/templates/multipanel/large-panel-three-small-1-3): A large panel for the main schematic or image on the left, and three graphs stacked on the right: the layout for a figure that leads with a mechanism and backs it with data. - [Six-panel figure (3 × 2)](https://www.labcanvas.com/templates/multipanel/six-panel-figure-3-2): Six panels a–f in three columns: a schematic and two images on top, three graphs below. - [Six-panel figure: characterizing gold nanoparticles](https://www.labcanvas.com/templates/multipanel/six-panel-figure-characterizing-gold-nanoparticles): A complete characterization figure for citrate-capped gold nanoparticles: the synthesis, a TEM image, the size histogram, the UV–vis plasmon band, the powder XRD pattern and the hydrodynamic size from DLS. - [Four-panel figure: cell viability and cytotoxicity](https://www.labcanvas.com/templates/multipanel/four-panel-figure-cell-viability-cytotoxicity): A cell-based assay figure: the treatment workflow on a 96-well plate, live/dead fluorescence images of control and treated cells, dose–response curves with fitted IC₅₀ values for two cell lines, and viability at one dose with every replicate and a one-way ANOVA against the control. - [Four-panel figure: tumour growth and survival in vivo](https://www.labcanvas.com/templates/multipanel/four-panel-figure-tumour-growth-survival-vivo): An in vivo efficacy figure: the dosing schedule on a timeline, tumour volume over time for three groups (mean ± SEM), Kaplan–Meier survival with a log-rank test, and body weight as a measure of tolerability. - [Four-panel figure: battery cathode performance](https://www.labcanvas.com/templates/multipanel/four-panel-figure-battery-cathode-performance): An electrochemistry figure for a cathode material: the cell, discharge profiles over cycling, capacity at rising C-rates and back, and long-term cycling with Coulombic efficiency on a second axis. - [Four-panel figure: a predicted protein structure and its confidence](https://www.labcanvas.com/templates/multipanel/four-panel-figure-predicted-protein-structure-confidence): A structure-prediction figure: the predicted model coloured by confidence, the per-residue pLDDT along the sequence, the predicted aligned error (PAE) map that shows which domains are placed confidently, and the predicted contact map. ### Journal covers - [Journal cover: genome editing](https://www.labcanvas.com/templates/journal-cover-art/dna-genome-editing-journal-cover): A cover in the style of a top journal: a full-bleed DNA render with glowing particles out of focus, a large serif masthead, the issue line and one cover story. - [Journal cover: single-atom catalysis](https://www.labcanvas.com/templates/journal-cover-art/single-atom-catalysis-journal-cover): A bold modern cover: glowing single-atom sites in graphene seen low across the sheet, a heavy sans masthead with a gold rule, a special-issue tag and the cover story. ### Graphene synthesis - [Mechanical exfoliation with adhesive tape](https://www.labcanvas.com/templates/graphene-synthesis/mechanical-exfoliation-scotch-tape-graphene): Graphene was first isolated by peeling graphite with ordinary adhesive tape. - [Liquid-phase exfoliation of graphite](https://www.labcanvas.com/templates/graphene-synthesis/liquid-phase-exfoliation-graphene): Graphite is split into thin sheets directly in a liquid. - [Graphene oxide: synthesis and characterization](https://www.labcanvas.com/templates/graphene-synthesis/graphene-oxide-synthesis-characterization): A six-panel figure on graphene oxide: the modified Hummers' route from graphite through graphite oxide and GO to reduced GO, the Lerf–Klinowski structural model with its oxygen groups, and representative XRD, Raman, FTIR and XPS C 1s spectra comparing graphite, GO and rGO. - [Doped carbon nanosheets from layered biochar](https://www.labcanvas.com/templates/graphene-synthesis/doped-carbon-nanosheets-layered-biochar): A layer-by-layer precursor of alternating inorganic and organic layers is carbonized in place, and the inorganic template is then leached out with acid. - [Electrochemical exfoliation of graphite](https://www.labcanvas.com/templates/graphene-synthesis/electrochemical-exfoliation-graphene): A graphite electrode is made the anode in an aqueous salt solution such as ammonium sulfate. - [Hummers method: graphite to GO to rGO](https://www.labcanvas.com/templates/graphene-synthesis/hummers-method-graphene-oxide-rgo): Graphite is oxidized in concentrated sulfuric acid with sodium nitrate and potassium permanganate, diluted with water, treated with hydrogen peroxide and sonicated into graphene oxide (GO) sheets. - [Improved Hummers method with K₂FeO₄](https://www.labcanvas.com/templates/graphene-synthesis/improved-hummers-method-k2feo4): A NaNO₃-free variant of the Hummers method in which potassium ferrate (K₂FeO₄) takes over part of the oxidizing work of KMnO₄. - [CVD growth of graphene on copper and nickel](https://www.labcanvas.com/templates/graphene-synthesis/cvd-graphene-growth-copper-nickel): In chemical vapour deposition, methane breaks down on a hot metal foil and its carbon assembles into graphene. - [CVD graphene on copper and PMMA transfer](https://www.labcanvas.com/templates/graphene-synthesis/cvd-graphene-pmma-transfer): Graphene grown by CVD on copper foil has to be moved onto an insulating substrate before it can be used in devices. - [Epitaxial graphene on SiC](https://www.labcanvas.com/templates/graphene-synthesis/epitaxial-graphene-sic): Graphene can be grown directly on a silicon carbide wafer, with no transfer. - [Graphene on SiC for remote epitaxy and layer transfer](https://www.labcanvas.com/templates/graphene-synthesis/graphene-remote-epitaxy-layer-transfer): Epitaxial graphene on SiC can serve as a reusable growth template. ### Graphene research - [Characterizing graphene](https://www.labcanvas.com/templates/graphene-research/characterizing-graphene): Six measurements tell you what a graphene flake is. - [Making a graphene transistor](https://www.labcanvas.com/templates/graphene-research/making-graphene-transistor): A graphene field-effect transistor is made with two rounds of lithography: the first patterns the graphene into a channel with an oxygen plasma, the second adds Cr/Au contacts by lift-off. - [Graphene transfer methods compared](https://www.labcanvas.com/templates/graphene-research/graphene-transfer-methods-compared): CVD graphene grows on metal and has to be moved before it is used. - [The graphene family of 2D materials](https://www.labcanvas.com/templates/graphene-research/graphene-family-2d-materials): Graphene is one of many crystals a few atoms thick. - [Making graphene: six routes compared](https://www.labcanvas.com/templates/graphene-research/making-graphene-six-routes-compared): Graphene is made top-down, by taking graphite apart, or bottom-up, from carbon atoms. - [Laser-induced and flash graphene](https://www.labcanvas.com/templates/graphene-research/laser-induced-flash-graphene): Two fast, solvent-free ways to graphene. - [Reading a graphene Raman spectrum](https://www.labcanvas.com/templates/graphene-research/reading-graphene-raman-spectrum): A one-page guide to the Raman spectrum of graphene: how the 2D band changes from one layer to graphite, the NPL monolayer criteria, what the 2D width says about the substrate, the defect distance from I(D)/I(G), the defect type from I(D)/I(D′), and the strain–doping map that separates the two. - [Characterizing graphene oxide](https://www.labcanvas.com/templates/graphene-research/characterizing-graphene-oxide): Six measurements of graphene oxide and reduced GO in one figure: the XPS C 1s components, FTIR bands of the oxygen groups, ¹³C solid-state NMR, the XRD interlayer spacing, the Raman D and G bands and carbon K-edge NEXAFS, each computed from reported values. - [Seeing graphene: a microscopy guide](https://www.labcanvas.com/templates/graphene-research/seeing-graphene-microscopy-guide): Six ways to look at graphene in one figure: optical contrast on SiO₂/Si, AFM heights and bubbles on hBN, SEM of CVD domains on copper, the TEM lattice and its diffraction, the STM moiré of graphene on hBN and LEED of epitaxial graphene on SiC. - [Dirac physics of graphene](https://www.labcanvas.com/templates/graphene-research/dirac-physics-graphene): The electronic structure of graphene in six computed panels: the honeycomb lattice and its Brillouin zone, the tight-binding π bands meeting at the Dirac points, the Dirac cone, ARPES of the linear bands, the half-integer quantum Hall effect and the bilayer whose gap opens with an interlayer asymmetry. - [Twisted bilayers and moiré superlattices](https://www.labcanvas.com/templates/graphene-research/twisted-bilayers-moire-superlattices): Twisted bilayer graphene and graphene on hBN in six panels: tear-and-stack assembly, the moiré pattern and its period, the two layers in 3D, the magic angle of 1.1°, the moiré of graphene on hBN from the 1.8 % lattice mismatch, and the moiré seen by STM. - [Defects and doping in graphene](https://www.labcanvas.com/templates/graphene-research/defects-doping-graphene): Defects and dopants in graphene in six panels: the Stone–Wales defect, a single vacancy, a grain boundary of 5-7 pairs, the nitrogen sites of N-doped graphene, transfer curves whose Dirac point shifts with doping, and the N 1s XPS that tells the nitrogen sites apart. - [Functionalised graphene and 3D forms](https://www.labcanvas.com/templates/graphene-research/functionalised-graphene-3d-forms): Graphene chemistry and architecture in six panels: covalent nitrophenyl groups, fluorographene and noncovalent pyrenebutyrate on the sheet, and graphene foam grown on nickel, a graphene aerogel and crumpled graphene balls in 3D. - [More ways to make graphene](https://www.labcanvas.com/templates/graphene-research/more-ways-make-graphene): Six more routes to graphene: hot-wall against cold-wall CVD, plasma-enhanced CVD of vertical graphene, wafer-scale single crystals on Ge(110), nanoribbons by unzipping nanotubes, six ways to reduce graphene oxide, and graphite intercalation stages for exfoliation. - [Processing graphene devices](https://www.labcanvas.com/templates/graphene-research/processing-graphene-devices): Six processing steps for graphene devices: annealing away PMMA residue, surface and substitutional chemical doping, ALD oxide on pristine and PTCA-functionalised graphene, ionic-liquid gating, one-dimensional edge contacts to hBN-encapsulated graphene, and the block-copolymer nanomesh. - [Graphene electronics](https://www.labcanvas.com/templates/graphene-research/graphene-electronics): Graphene devices in six panels: a Hall bar on SiO₂/Si, an hBN-encapsulated device with edge contacts, the field-effect transfer curve, RF transistors with an f_T benchmark, a suspended mechanical resonator, and the quantum Hall resistance standard on epitaxial graphene. - [Graphene for energy](https://www.labcanvas.com/templates/graphene-research/graphene-energy): Graphene in energy storage and conversion in six panels: activated graphene with nanometre pores, laser-scribed graphene from a DVD drive, micro-supercapacitors written on one disc, nitrogen-doped graphene for oxygen reduction against platinum, and graphene/silicon Schottky solar cells. - [Graphene sensors and optoelectronics](https://www.labcanvas.com/templates/graphene-research/graphene-sensors-optoelectronics): Graphene sensing and optoelectronics in six panels: single NO₂ molecules detected as resistance steps, a metal–graphene–metal photodetector and its frequency response, a flexible transparent electrode and transparent neural electrodes that neurons are imaged through. - [Graphene membranes and water](https://www.labcanvas.com/templates/graphene-research/graphene-membranes-water): Graphene separation membranes in six panels: nanoporous single-layer graphene for desalination, swollen and confined graphene-oxide laminates sieving ions, porous graphene sieving gases, protons crossing monolayer graphene, and an rGO-coated sponge separating oil from water. - [Graphene scale-up and quality control](https://www.labcanvas.com/templates/graphene-research/graphene-scale-up-quality-control): Graphene manufacturing in six panels: roll-to-roll CVD in a concentric-tube reactor, a roll-to-roll transfer line onto PET, metre-sized single crystals on industrial Cu foil, THz sheet-conductance and Raman quality maps, and the framework that classifies graphene-based materials. ### Nanomaterial synthesis - [Green synthesis of silver and gold nanoparticles](https://www.labcanvas.com/templates/nanomaterial-synthesis/green-synthesis-silver-gold-nanoparticles): Leaves are boiled in water and the filtered extract is added to silver nitrate or chloroauric acid. - [Turkevich citrate reduction of gold nanoparticles](https://www.labcanvas.com/templates/nanomaterial-synthesis/turkevich-method-gold-nanoparticles): Trisodium citrate is added to a boiling solution of chloroauric acid. - [Seed-mediated growth of gold nanorods](https://www.labcanvas.com/templates/nanomaterial-synthesis/seed-mediated-growth-gold-nanorods): Small CTAB-capped gold seeds are made by reducing HAuCl₄ with ice-cold sodium borohydride in CTAB. - [Co-precipitation of magnetite (Fe₃O₄) nanoparticles](https://www.labcanvas.com/templates/nanomaterial-synthesis/magnetite-fe3o4-nanoparticles-co-precipitation): Ferrous and ferric salts in a 1 : 2 ratio are precipitated together by adding a base such as ammonia, under nitrogen so that Fe²⁺ is not oxidized. - [Hydrothermal synthesis of carbon dots](https://www.labcanvas.com/templates/nanomaterial-synthesis/carbon-dots-hydrothermal-synthesis): Citric acid and ethylenediamine are dissolved in water and heated in a sealed Teflon-lined autoclave. - [g-C₃N₄ by thermal polymerization](https://www.labcanvas.com/templates/nanomaterial-synthesis/g-c3n4-thermal-polymerization-melamine): Melamine is heated in a covered crucible in a muffle furnace. - [Hydrothermal growth of ZnO nanorod arrays](https://www.labcanvas.com/templates/nanomaterial-synthesis/zno-nanorods-hydrothermal-growth): A substrate is coated with ZnO nanocrystals that act as seeds and annealed. - [Sol–gel synthesis of TiO₂ and SiO₂](https://www.labcanvas.com/templates/nanomaterial-synthesis/sol-gel-synthesis-tio2-sio2): A metal alkoxide such as titanium isopropoxide (for TiO₂) or tetraethyl orthosilicate (for SiO₂) is mixed with water in alcohol, with an acid or base as catalyst. - [Stöber synthesis of monodisperse silica spheres](https://www.labcanvas.com/templates/nanomaterial-synthesis/stober-method-silica-nanoparticles): Tetraethyl orthosilicate (TEOS) is added to a stirred mixture of ethanol, water and ammonia. - [MCM-41 mesoporous silica by surfactant templating](https://www.labcanvas.com/templates/nanomaterial-synthesis/mcm-41-mesoporous-silica-synthesis): Cationic surfactant (CTAB) in water forms spherical micelles and, at higher concentration, rod-like micelles that pack into a hexagonal array. - [MOF synthesis: ZIF-8 and UiO-66](https://www.labcanvas.com/templates/nanomaterial-synthesis/zif-8-uio-66-mof-synthesis): Metal–organic frameworks form when metal ions or clusters link through organic ligands into porous crystals. - [MXene (Ti₃C₂Tₓ) by selective etching of Ti₃AlC₂](https://www.labcanvas.com/templates/nanomaterial-synthesis/mxene-ti3c2-selective-etching): The MAX phase Ti₃AlC₂ is a layered carbide in which Ti₃C₂ layers are held together by aluminium. - [Liposomes by thin-film hydration and extrusion](https://www.labcanvas.com/templates/nanomaterial-synthesis/liposomes-thin-film-hydration-extrusion): Phospholipids such as phosphatidylcholine, usually with cholesterol, are dissolved in chloroform and the solvent is removed on a rotary evaporator, leaving a thin lipid film on the flask wall. ### Nanomaterial guides - [Six wet-chemical routes to nanoparticles](https://www.labcanvas.com/templates/nanomaterial-guides/six-wet-chemical-routes-nanoparticles): Six wet-chemical syntheses on one page, each drawn step by step: citrate reduction of gold (Turkevich), the Brust–Schiffrin two-phase synthesis of thiol-protected gold, silver nanowires by the polyol route, hot injection against heat-up for semiconductor nanocrystals, co-precipitation of magnetite and reverse micelles. - [Nanorods, nanowires and nanocages from seeds](https://www.labcanvas.com/templates/nanomaterial-guides/nanorods-nanowires-nanocages-seeds): Growth from seeds in six panels: seed-mediated gold nanorods step by step and one rod with CTAB and silver on its sides, a penta-twinned silver nanowire capped by PVP, and galvanic replacement turning silver nanocubes into nanoboxes, nanocages and nanoframes. - [How nanoparticles nucleate, grow and ripen](https://www.labcanvas.com/templates/nanomaterial-guides/how-nanoparticles-nucleate-grow-ripen): Six ways the sizes of nanoparticles are set, drawn as particles and arrows: burst nucleation and diffusion-controlled growth, seeds that form first in the Turkevich synthesis and then grow, Ostwald ripening, oriented attachment, digestive ripening and size-selective precipitation afterwards. - [Physical and gas-phase routes to nanoparticles](https://www.labcanvas.com/templates/nanomaterial-guides/physical-gas-phase-routes-nanoparticles): Six physical and gas-phase processes for making or coating particles: laser ablation in liquid and its plasma-to-colloid sequence, the temperature zones of flame spray pyrolysis, a magnetron gas-aggregation cluster source with a mass filter, spray drying of a droplet into a glassy microparticle, and the trimethylaluminium–water cycle of atomic layer deposition. - [Microfluidic synthesis and electrospinning](https://www.labcanvas.com/templates/nanomaterial-guides/microfluidic-synthesis-electrospinning): Continuous processes in six panels: hydrodynamic flow focusing, a staggered herringbone mixer, glass-capillary 3D focusing and droplet microfluidics for nanoparticle synthesis, then the electrospinning set-up and its four steps from Taylor cone to fibre mat. - [Shape control of metal nanocrystals](https://www.labcanvas.com/templates/nanomaterial-guides/shape-control-metal-nanocrystals): Why metal nanocrystals come out as cubes, cuboctahedra, octahedra, bipyramids, decahedra, icosahedra, wires or plates: single-crystal seeds take the shape set by the growth rates along ⟨111⟩ and ⟨100⟩, capping agents such as PVP, bromide and citrate pick the facet that is exposed, and twinned or faulted seeds grow into bipyramids, multiply twinned particles, wires and plates. - [Measuring nanoparticles in liquid: size and charge](https://www.labcanvas.com/templates/nanomaterial-guides/measuring-nanoparticles-liquid-size-charge): Six principles for characterising a colloid: dynamic light scattering and what its hydrodynamic diameter includes, nanoparticle tracking analysis, the electrical double layer and the zeta potential, the electrophoresis cell that measures it, and small-angle X-ray scattering. - [What nanoparticles are made of: STEM, ICP-MS and magnetometry](https://www.labcanvas.com/templates/nanomaterial-guides/what-nanoparticles-are-made-stem-icp-ms-magnetometry): Six principles for finding what nanoparticles are made of and how their elements are arranged: preparing a TEM grid, HAADF-STEM with its Z-contrast, EDS detectors around the specimen, ICP-MS from acid digestion to the plasma, single-particle ICP-MS and the vibrating-sample magnetometer. - [Nanoparticles in medicine: heating, imaging, targeting and killing bacteria](https://www.labcanvas.com/templates/nanomaterial-guides/nanoparticles-medicine-heating-imaging-targeting-killing-bacteria): Six nanomedicine principles on one page: photothermal therapy with gold nanorods, magnetic hyperthermia with iron oxide, T1 and T2 MRI contrast agents, upconversion nanoparticles for imaging deep in tissue, theranostic particles that leave leaky tumour vessels, and antibacterial silver. - [Nanoparticles in tests, catalysts and devices](https://www.labcanvas.com/templates/nanomaterial-guides/nanoparticles-tests-catalysts-devices): Six applications of nanoparticles outside medicine: colorimetric detection with oligonucleotide–gold probes, the lateral flow strip, plasmonic hot-electron photocatalysis, the three-way catalytic converter, quantum-dot colour conversion on blue micro-LEDs and mineral sunscreens of TiO₂ and ZnO. - [From synthesis to application: a nanoparticle workflow in pictograms](https://www.labcanvas.com/templates/nanomaterial-guides/synthesis-application-nanoparticle-workflow-pictograms): A nanoparticle project in 24 editable pictograms: six ways to make the particles, six steps to clean them up and choose their surface, six ways to measure them and six places they are put to work. ### Metal–organic frameworks - [MOF-5: synthesis and structure](https://www.labcanvas.com/templates/metal-organic-frameworks/mof-5-synthesis-structure): MOF-5 (IRMOF-1) is the prototypical metal–organic framework. - [HKUST-1: copper paddlewheels and open metal sites](https://www.labcanvas.com/templates/metal-organic-frameworks/hkust-1-cu-btc-open-metal-sites): HKUST-1 (Cu-BTC) forms in high yield when copper(II) nitrate and trimesic acid are heated in water and ethanol. - [Isoreticular MOFs: one net, designed pores](https://www.labcanvas.com/templates/metal-organic-frameworks/irmof-isoreticular-series-pore-size): Keeping the Zn₄O node and the cubic net of MOF-5 while changing only the linker gave a series of 16 isoreticular frameworks (IRMOFs): longer struts (naphthalene, biphenyl, terphenyl…) widen the pores step by step, and groups on the benzene ring (–Br, –NH₂, alkoxy, fused rings) change what lines them. - [UiO-66: modulators and missing-linker defects](https://www.labcanvas.com/templates/metal-organic-frameworks/uio-66-missing-linker-defects-modulators): Monocarboxylic acids added to the synthesis of UiO-66 compete with terephthalate for the Zr₆ clusters. - [MIL-101(Cr): supertetrahedra and giant cages](https://www.labcanvas.com/templates/metal-organic-frameworks/mil-101-cr-supertetrahedra-mesoporous-cages): MIL-101 is a chromium terephthalate made hydrothermally with HF. - [Post-synthetic modification of a MOF](https://www.labcanvas.com/templates/metal-organic-frameworks/mof-post-synthetic-modification-irmof-3): Functional groups can be added to a framework after it has formed. - [Characterizing a new MOF](https://www.labcanvas.com/templates/metal-organic-frameworks/mof-characterization-pxrd-bet-tga): A new framework is only as good as its evidence. - [Mg-MOF-74: open metal sites for CO₂ capture](https://www.labcanvas.com/templates/metal-organic-frameworks/mg-mof-74-co2-capture): In Mg-MOF-74, chains of magnesium ions joined by 2,5-dioxidoterephthalate line one-dimensional hexagonal channels. - [MOF-801: water from desert air](https://www.labcanvas.com/templates/metal-organic-frameworks/mof-801-water-harvesting): MOF-801 is a zirconium fumarate with the same net as UiO-66 and small pores that fill with water over a narrow range of low humidity. - [Iron MOF nanoparticles for drug delivery](https://www.labcanvas.com/templates/metal-organic-frameworks/mil-100-fe-nanoparticles-drug-delivery): Nanoparticles of MIL-100(Fe), an iron(III) trimesate with mesoporous cages, soak up large amounts of drugs that are hard to formulate, such as busulfan, the antiviral AZT triphosphate, cidofovir and doxorubicin. ### MOF guides - [MOF synthesis: solvothermal, room temperature, modulated](https://www.labcanvas.com/templates/mof-guides/mof-synthesis-solvothermal-room-temperature-modulated): The classic routes to metal–organic frameworks on one page: solvothermal MOF-5 in a Teflon-lined vessel, UiO-66 step by step, hydrothermal HKUST-1 from molecules to the framework, ZIF-8 mixed at room temperature in methanol, how the Hmim/Zn ratio sets its crystals, and modulators that compete with the linker. - [Fast, green and scalable MOF synthesis](https://www.labcanvas.com/templates/mof-guides/fast-green-scalable-mof-synthesis): Rapid and scalable routes to metal–organic frameworks on one page: oven, ultrasound and microwave times compared, ZIF-8 by ball milling with a liquid and a salt, ZIF-8 by solvent-free twin-screw extrusion, HKUST-1 by anodic dissolution of copper, nanoMOF spheres by spray drying, and how a crystal forms from building units. - [Activating and shaping MOFs](https://www.labcanvas.com/templates/mof-guides/activating-shaping-mofs): MOF activation and shaping on one page: solvent exchange followed by heating under vacuum, the three ways to empty the pores (vacuum, supercritical CO₂, freeze-drying), pore collapse as the solvent leaves, and the shaped forms (pellets, extrudates, granules, sol–gel and 3D-printed monoliths), what lies inside them and a dense sol–gel monolith. - [MOF thin films and membranes](https://www.labcanvas.com/templates/mof-guides/mof-thin-films-membranes): MOF films and membranes on one page: layer-by-layer growth of SURMOFs on a self-assembled monolayer, vapour-phase conversion of ZnO into ZIF-8, the six ways to make a film (with Langmuir–Blodgett and patterning), the kinds of membrane (supported, mixed-matrix, nanosheet, hollow-fibre), seeded growth of a ZIF-8 membrane and molecular sieving of propylene from propane. - [MOF glasses, MOF-derived materials and composites](https://www.labcanvas.com/templates/mof-guides/mof-glasses-mof-derived-materials-composites): What MOFs become on one page: ZIF-62 melted under argon and quenched into a glass, the network of the crystal, the liquid and the glass, a crystal–glass composite of MIL-53 in ZIF-62, ZIF-8 carbonised in a tube furnace, the routes from MOFs to carbons, metal nanoparticles, single atoms and oxides, and MOF composites with nanoparticles, fibres and graphene. - [Reticular design: building units, linkers and nets](https://www.labcanvas.com/templates/mof-guides/reticular-design-building-units-linkers-nets): Reticular design of metal–organic frameworks on one page: MOF-5 from Zn₄O units and BDC on the pcu net, HKUST-1 deconstructed into the tbo net, UiO-66 on fcu, the library of inorganic SBUs and organic linkers by their points of extension, and the RCSR nets of well-known MOFs. - [Isoreticular expansion, interpenetration, MTV MOFs](https://www.labcanvas.com/templates/mof-guides/isoreticular-expansion-interpenetration-mtv-mofs): Isoreticular design on one page: the IRMOF series from MOF-5 to IRMOF-16, IRMOF-74-I to -XI with apertures up to 98 Å, HKUST-1 and MOF-399 on the tbo net, interpenetrated IRMOF-9 against IRMOF-10, ways to prevent or use interpenetration, and multivariate MOF-5 with several functional groups on one backbone. - [Flexible and defective MOFs](https://www.labcanvas.com/templates/mof-guides/flexible-defective-mofs): MOF flexibility and defects on one page: MIL-53 breathing between large and narrow pores with water, the imidazolate linker swing that opens ZIF-8, the sudden pore contraction of DUT-49 that pushes methane out, missing-linker and missing-cluster defects in UiO-66, correlated missing clusters in reo nano-regions, and what caps the freed sites. - [Post-synthetic modification, stability, conductivity](https://www.labcanvas.com/templates/mof-guides/post-synthetic-modification-stability-conductivity): Changing and keeping MOFs on one page: the five kinds of post-synthetic modification (covalent, dative, linker exchange, metal-ion exchange, metalation by ALD), how water hydrolyses a metal–linker bond, hard–soft pairing of metal and linker, the strategies that make MOFs water-stable, the conductive honeycomb Ni₃(HITP)₂ and the routes charge takes through a MOF. - [Characterizing MOFs: pores, structure, defects and uptake](https://www.labcanvas.com/templates/mof-guides/characterizing-mofs-pores-structure-defects-uptake): MOF characterization set-ups on one page: a volumetric gas sorption analyser with its degassing and free-space steps, 3D electron diffraction of a nanocrystal at a low dose, digestion ¹H NMR to count linkers and capping groups, a single crystal in a gas cell for in situ diffraction, a breakthrough rig for dry and humid gas mixtures, and gravimetric water sorption. ### Covalent organic frameworks - [COF-1 and COF-5: the first COFs](https://www.labcanvas.com/templates/covalent-organic-frameworks/cof-1-cof-5-boroxine-boronate-ester): The first covalent organic frameworks were made in 2005 by condensing boronic acids. - [COF linkages: from reversible to robust](https://www.labcanvas.com/templates/covalent-organic-frameworks/cof-linkages-boroxine-imine-ketoenamine-triazine): A COF crystallizes only if its bonds can break and re-form while it grows, so that mistakes heal. - [TpPa COFs: β-ketoenamine links that survive acid and base](https://www.labcanvas.com/templates/covalent-organic-frameworks/tppa-1-ketoenamine-cof-acid-base-stability): TpPa-1 and TpPa-2 are made from 1,3,5-triformylphloroglucinol (Tp) and p-phenylenediamine or its 2,5-dimethyl analogue. - [COF-LZU1: an imine COF that holds palladium](https://www.labcanvas.com/templates/covalent-organic-frameworks/cof-lzu1-pd-suzuki-coupling-catalysis): COF-LZU1 condenses 1,3,5-triformylbenzene with p-phenylenediamine into imine-linked layers that stack eclipsed, so the imine nitrogens of neighbouring layers line up. - [3D COFs: COF-102 and COF-300](https://www.labcanvas.com/templates/covalent-organic-frameworks/3d-cof-102-cof-300-diamond-net): Tetrahedral building blocks take covalent organic frameworks into three dimensions. - [CTF-1: triazine frameworks from molten salt](https://www.labcanvas.com/templates/covalent-organic-frameworks/ctf-1-ionothermal-covalent-triazine-framework): Covalent triazine frameworks are made without any condensation water: aromatic nitriles trimerize into triazine rings in molten zinc chloride at 400 °C, the salt serving as solvent and catalyst. - [Characterizing a 2D COF](https://www.labcanvas.com/templates/covalent-organic-frameworks/cof-characterization-pxrd-ftir-nmr): Four questions decide whether a new 2D COF is the framework that was designed. - [COF-366-Co: cobalt porphyrin COF for CO₂ reduction](https://www.labcanvas.com/templates/covalent-organic-frameworks/cof-366-co-porphyrin-co2-reduction): Cobalt porphyrins joined by imine struts form square-grid layers that stack into a porous solid with a catalytic cobalt site at every corner. - [COF photocatalysts for hydrogen from water](https://www.labcanvas.com/templates/covalent-organic-frameworks/cof-photocatalytic-hydrogen-evolution): Some COFs are semiconductors that absorb visible light. - [COF thin films for molecular separation](https://www.labcanvas.com/templates/covalent-organic-frameworks/cof-thin-film-membranes-interfacial-crystallization): COFs usually come out as insoluble powders. ### Battery materials - [Inside a lithium-ion cell, from can to crystal (3D renders)](https://www.labcanvas.com/templates/battery-materials/inside-lithium-ion-cell-can-crystal-3d-renders): A graphical abstract made of path-traced 3D renders: a cylindrical lithium-ion cell cut away, its electrode stack in cross-section, and the two crystals that host the lithium, layered LiCoO₂ and graphite. - [How a lithium-ion battery works](https://www.labcanvas.com/templates/battery-materials/lithium-ion-battery-how-it-works-rocking-chair): A lithium-ion battery stores energy by moving lithium ions between two host materials. - [LiCoO₂: the layered oxide cathode](https://www.labcanvas.com/templates/battery-materials/licoo2-layered-oxide-cathode-structure): Lithium cobalt oxide, the cathode of the first lithium-ion cells, is built of CoO₂ slabs with lithium in the layers between them, where it can move freely in two dimensions. - [LiFePO₄: the olivine cathode](https://www.labcanvas.com/templates/battery-materials/lifepo4-olivine-cathode-two-phase): Lithium iron phosphate is cheap, non-toxic and very stable: iron and phosphate build a rigid olivine framework, and lithium sits in one-dimensional channels running through it. - [LiMn₂O₄: the spinel cathode](https://www.labcanvas.com/templates/battery-materials/limn2o4-spinel-cathode-jahn-teller): Manganese spinel is cheap and fast: MnO₆ octahedra form a three-dimensional framework, and lithium in tetrahedral sites can move in all three directions. - [Ni-rich NMC: more capacity, less stability](https://www.labcanvas.com/templates/battery-materials/nmc811-nickel-rich-cathode-co-precipitation): NMC cathodes replace most of LiCoO₂’s cobalt with nickel and some manganese, all sharing one layer of the same structure. - [The graphite anode: staging and the SEI](https://www.labcanvas.com/templates/battery-materials/graphite-anode-staging-sei-formation): Graphite stores lithium between its graphene layers, filling them in stages, every fourth, third, second and finally every gallery as LiC₆, which opens the layers by about 10%. - [Silicon anodes: huge capacity, huge swelling](https://www.labcanvas.com/templates/battery-materials/silicon-anode-volume-expansion-nanowires): Silicon can take up almost ten times more lithium per gram than graphite, but it swells to nearly four times its volume as it does. - [Lithium–sulfur: a carbon host and the polysulfide shuttle](https://www.labcanvas.com/templates/battery-materials/lithium-sulfur-battery-cmk-3-polysulfide-shuttle): Sulfur can store far more lithium per gram than any oxide cathode, by turning all the way into Li₂S. - [Solid-state batteries: ceramic electrolytes](https://www.labcanvas.com/templates/battery-materials/solid-state-battery-lgps-llzo-electrolytes): A solid-state battery replaces the flammable liquid electrolyte with a ceramic that conducts lithium ions, which could also make a lithium-metal anode practical. - [Making and testing a coin cell](https://www.labcanvas.com/templates/battery-materials/cr2032-coin-cell-assembly-testing): Most new battery materials are first tried in a CR2032 coin cell, a steel can 20 mm across and 3.2 mm thick. ### Battery & energy storage guides - [Making cathode materials: NMC and LiFePO₄](https://www.labcanvas.com/templates/energy-storage-guides/making-cathode-materials-nmc-lifepo4): Cathode synthesis on one page: the Ni–Mn–Co hydroxide precursor co-precipitated in a stirred tank, lithiated and calcined in oxygen into layered NMC, polycrystalline against single-crystal particles, LiFePO₄ made hydrothermally and coated with carbon, and an Al₂O₃ coating grown by atomic layer deposition. - [Anode and electrolyte materials](https://www.labcanvas.com/templates/energy-storage-guides/anode-electrolyte-materials): Anode and electrolyte materials on one page: hard carbon pyrolysed from biomass or resin and how it stores sodium, silicon nanoparticles held in yolk–shell and pomegranate carbon, a LiPF₆ carbonate electrolyte made in a glovebox, the HF that trace water makes from it, and the argyrodite solid electrolyte Li₆PS₅Cl. - [Making battery electrodes: from slurry to slit coils](https://www.labcanvas.com/templates/energy-storage-guides/making-battery-electrodes-slurry-slit-coils): Electrode manufacturing on one page: slurry mixing in a planetary mixer, slot-die coating and drying with solvent recovery, the coating bead and its defects, calendering between heated rolls, slitting and the cut edge, and the dry route with fibrillated PTFE. - [Building and forming a battery cell](https://www.labcanvas.com/templates/energy-storage-guides/building-forming-battery-cell): Cell assembly on one page: winding and stacking in a dry room, cylindrical, prismatic and pouch formats, an 18650 cell in section with its mandrel, PTC switch and CID vent disk, the tabless 4680 design, and electrolyte filling, formation and aging. - [How electrodes store lithium](https://www.labcanvas.com/templates/energy-storage-guides/how-electrodes-store-lithium): How battery electrodes store lithium, on one page: intercalation into a layered host, alloying with silicon that swells and cracks, conversion of a metal oxide into metal nanoparticles in Li₂O, the solvation sheath round Li⁺, the SEI on graphite and the electrolyte window between LUMO and HOMO. - [Electrolytes and interphases](https://www.labcanvas.com/templates/energy-storage-guides/electrolytes-interphases): Electrolyte design on one page: the superconcentrated LiFSA/DMC network, a localized high-concentration electrolyte with an inert diluent, desolvation at graphite, the two-layer SEI on silicon, a CEI on NCM811, and manganese and nickel crossing from the cathode to the graphite. - [Lithium metal and solid-state batteries](https://www.labcanvas.com/templates/energy-storage-guides/lithium-metal-solid-state-batteries): Lithium metal and solid-state cells on one page: plating and stripping with a cracking SEI and dead lithium, dendrites as faceted nanowires, an anode-free cell on coated copper, a sulfide composite cathode, voids and grain-boundary lithium at a solid electrolyte, and an ALD Al₂O₃ layer that lets lithium wet a garnet. - [Sodium-ion and potassium-ion batteries](https://www.labcanvas.com/templates/energy-storage-guides/sodium-ion-potassium-ion-batteries): Beyond lithium on one page: a sodium-ion cell with aluminium foil on both electrodes, hard carbon and where it stores sodium, a P2 layered oxide, a Prussian blue analogue and a NASICON phosphate cathode, and potassium entering graphite in stages. - [How lithium-ion cells age](https://www.labcanvas.com/templates/energy-storage-guides/how-lithium-ion-cells-age): Lithium-ion degradation on one page: where a cell ages, the SEI and cracking on graphite, lithium plating, the degrading cathode, manganese crossing to the anode and the gas that swells a pouch cell. - [Battery safety: abuse and thermal runaway](https://www.labcanvas.com/templates/energy-storage-guides/battery-safety-abuse-thermal-runaway): Lithium-ion safety on one page: nail penetration, overcharge and oven abuse tests, the thermal-runaway temperature ladder from SEI decomposition to oxygen release, a shutdown separator, and runaway spreading through a module. - [Seeing inside a working battery](https://www.labcanvas.com/templates/energy-storage-guides/seeing-inside-working-battery): Battery characterisation set-ups on one page: an operando X-ray diffraction cell, XPS of the SEI without air with sputter depth profiling, synchrotron X-ray tomography of an 18650 cell, neutron imaging of gas in a pouch cell, operando neutron diffraction of a cylindrical cell, and why neutrons see lithium. - [Electrochemical and safety measurements](https://www.labcanvas.com/templates/energy-storage-guides/electrochemical-safety-measurements): Battery measurements on one page: electrochemical impedance from the perturbation to the equivalent circuit, a three-electrode cell with a lithium reference, online gas analysis by mass spectrometry, accelerating rate calorimetry by heat–wait–seek, and titration gas chromatography of dead lithium. - [From cells to packs, cars and the grid](https://www.labcanvas.com/templates/energy-storage-guides/cells-packs-cars-grid): Battery systems on one page: an exploded battery pack, passive and active cell balancing, four ways to manage the temperature, a cell-to-pack design, an electric car with its pack and drive, and a grid storage container with its fire and gas safety. - [Recycling, second life and other energy storage](https://www.labcanvas.com/templates/energy-storage-guides/recycling-second-life-other-energy-storage): The end of a battery’s life and the wider storage picture on one page: pretreatment of spent batteries, hydrometallurgical and direct recycling, the second-life loop from the car to stationary storage, and the other ways to store energy, from pumped hydro, compressed air, flywheels and heat to hydrogen, supercapacitors, flow batteries and lithium-ion. - [A battery’s life in pictograms: make, build, test, use and recycle](https://www.labcanvas.com/templates/energy-storage-guides/battery-s-life-pictograms-make-build-test-use-recycle): A battery’s life in 24 editable pictograms: six steps to make the materials, six to build the cell, six ways to test it and six for its use and recycling. ### Electrocatalysis - [Water splitting: hydrogen and oxygen evolution](https://www.labcanvas.com/templates/electrocatalysis/water-splitting-her-oer-overpotential): An electrolyzer splits water into hydrogen at the cathode and oxygen at the anode. - [The OER mechanism: four proton–electron steps](https://www.labcanvas.com/templates/electrocatalysis/oer-mechanism-free-energy-diagram): Oxygen evolution on an oxide takes four proton–electron steps on one metal site, through HO*, O* and HOO*. - [Single-atom catalysts: one metal atom, four nitrogens](https://www.labcanvas.com/templates/electrocatalysis/single-atom-catalysts-co-n-c-zif-pyrolysis): A single-atom catalyst spreads its metal as isolated atoms, each held by nitrogen in a carbon sheet, so every metal atom can be an active site. - [CO₂ reduction on copper: many products](https://www.labcanvas.com/templates/electrocatalysis/co2-reduction-copper-c2-products): Most metals reduce CO₂ to one simple product: formate on tin, indium or lead, CO on silver or gold. - [CO₂ electrolyzers: gas-diffusion electrodes](https://www.labcanvas.com/templates/electrocatalysis/co2-electrolyzer-flow-cell-gas-diffusion-electrode): In an H-cell, CO₂ must dissolve before it reaches the catalyst, and that caps the current. - [Fuel cells: oxygen reduction on platinum alloys](https://www.labcanvas.com/templates/electrocatalysis/pem-fuel-cell-orr-pt3ni-platinum-skin): A PEM fuel cell turns hydrogen and oxygen into water and electricity; the slow step is oxygen reduction at the platinum cathode. - [MoS₂ for hydrogen: the edges do the work](https://www.labcanvas.com/templates/electrocatalysis/mos2-edge-sites-hydrogen-evolution): Molybdenum disulfide is a cheap, layered alternative to platinum for making hydrogen, but only the edges of its layers are active: the flat basal plane hardly binds hydrogen. - [NiFe layered double hydroxides for oxygen evolution](https://www.labcanvas.com/templates/electrocatalysis/nife-ldh-oxygen-evolution-catalyst): Nickel–iron layered double hydroxides are the benchmark oxygen-evolution catalysts in alkaline water. - [MOF-derived catalysts: from framework to carbon](https://www.labcanvas.com/templates/electrocatalysis/mof-derived-fe-n-c-electrocatalysts): Heat a metal–organic framework and its linkers become nitrogen-doped carbon that often keeps the crystal’s shape, while its metals end up as single atoms held by nitrogen or as small particles. - [Benchmarking an electrocatalyst](https://www.labcanvas.com/templates/electrocatalysis/electrocatalyst-benchmarking-lsv-tafel-ecsa-eis): To compare catalysts across labs, measure them the same way: in a three-electrode cell with a rotating disk, correct for the ohmic drop, report the overpotential at 10 mA cm⁻², the Tafel slope, the active surface area from the double-layer capacitance, the charge-transfer resistance, and how the potential holds over time. ### Graphical abstracts - [Perovskite solar cell: from crystal to device](https://www.labcanvas.com/templates/graphical-abstracts/perovskite-solar-cell-crystal-device): A zoom-in cascade through a perovskite solar cell: the device stack, its light-absorbing polycrystalline film between the two charge contacts, and the ABX₃ crystal of corner-sharing octahedra as a live 3D model. - [How an OLED makes light](https://www.labcanvas.com/templates/graphical-abstracts/how-oled-makes-light): A graphical abstract of an organic light-emitting diode: holes and electrons step in from the electrodes over a ladder of HOMO and LUMO levels, cross the transport layers of an exploded pixel stack and meet in the emissive layer. - [Fibre-reinforced composites: from layup to strength](https://www.labcanvas.com/templates/graphical-abstracts/fibre-reinforced-composites-layup-strength): A split-screen graphical abstract: on one side a brittle epoxy matrix that cracks, on the other stiff carbon fibres that carry the load. - [Tough hydrogels: sacrificial bonds that break so the gel does not](https://www.labcanvas.com/templates/graphical-abstracts/tough-hydrogels-sacrificial-bonds-that-break-so-gel-does-not): A radial graphical abstract on tough hydrogels: a live 3D water-swollen polymer network at the hub, with four satellites on its structure, the sacrificial-bond mechanism, the numbers and the uses. - [Sodium-ion batteries: abundant sodium, stored in hard carbon](https://www.labcanvas.com/templates/graphical-abstracts/sodium-ion-batteries-abundant-sodium-stored-hard-carbon): A split graphical abstract: a navy band makes the case for sodium against lithium (abundance, ion size, potential and the aluminium current collector), and the white field follows the sodium ion from the cell into hard carbon, where a sloping region of adsorption and a low-voltage plateau of pore filling and intercalation store it. - [Supercapacitor electrodes: zooming in on ions in carbon pores](https://www.labcanvas.com/templates/graphical-abstracts/supercapacitor-electrodes-zooming-ions-carbon-pores): A zoom-in cascade from a supercapacitor cell to the porous carbon of its electrode, the double layer of ions on a charged wall, and a sub-nanometre pore where ions shed their solvent. - [Thermoelectrics: scattering heat-carrying phonons at every length scale](https://www.labcanvas.com/templates/graphical-abstracts/thermoelectrics-scattering-heat-carrying-phonons-at-every-length-scale): A length-scale ladder for thermoelectric materials: waste heat enters, and the phonons that carry it are scattered by atomic disorder and anharmonic bonds, by nanoscale precipitates and by mesoscale grain boundaries before a thermoelectric module turns heat into electricity. - [Hydrogen storage materials: four ways to hold H₂](https://www.labcanvas.com/templates/graphical-abstracts/hydrogen-storage-materials-four-ways-hold-h2): A radial graphical abstract with a hydrogen molecule at the hub and the four ways to store it on the spokes: compressed gas, cryogenic liquid, physisorption in a metal–organic framework and chemical binding in magnesium hydride. - [Redox flow batteries: energy in the tanks, power in the stack](https://www.labcanvas.com/templates/graphical-abstracts/redox-flow-batteries-energy-tanks-power-stack): A redox flow battery cut open inside a circulating loop of its two electrolytes, tagged with the idea that defines it: energy scales with the tanks and power with the stack. - [Nanozymes: nanoparticles that act like enzymes](https://www.labcanvas.com/templates/graphical-abstracts/nanozymes-nanoparticles-that-act-like-enzymes): A radial graphical abstract: one nanoparticle at the hub and four enzyme-like activities around it, each on the material that showed it. - [High-entropy alloys: five metals, one phase](https://www.labcanvas.com/templates/graphical-abstracts/high-entropy-alloys-five-metals-phase): A funnel-shaped graphical abstract: five metals pour into one high-entropy alloy nanoparticle, made either by a 55 ms carbothermal shock or by slowly reducing a mixed precursor. - [Self-healing polymers: four ways to close a crack](https://www.labcanvas.com/templates/graphical-abstracts/self-healing-polymers-four-ways-close-crack): A timeline drawn along one crack that closes from left to right. - [Monolayer MoS₂: from one atomic layer to logic](https://www.labcanvas.com/templates/graphical-abstracts/monolayer-mos2-atomic-layer-logic): A chain of four lenses builds a chip up from one S–Mo–S layer: thinned to a monolayer, MoS₂ turns into a direct-gap semiconductor that lights up; a top-gated monolayer transistor switches by a factor of 10⁸; and the layer carries inverters, NOR logic and gates just 1 nm long. - [Daytime radiative cooling: cooling under the sun with the cold of space](https://www.labcanvas.com/templates/graphical-abstracts/daytime-radiative-cooling-cooling-under-sun-cold-space): A sky-and-ground graphical abstract: a cooler on a rooftop sends sunlight back and radiates heat to space through the 8–13 µm atmospheric window, staying below the air temperature in full sun with no electricity. - [Silica aerogel: from sol to superinsulator](https://www.labcanvas.com/templates/graphical-abstracts/silica-aerogel-sol-superinsulator): A timeline of how silica aerogel is made: a silica sol gels into a wet particle network, ages, and is dried without letting its pores collapse, by supercritical CO₂ or by ambient-pressure drying after silylation. - [Shape-selective catalysis in zeolites: from pellet to pore window](https://www.labcanvas.com/templates/graphical-abstracts/shape-selective-catalysis-zeolites-pellet-pore-window): A concentric zoom into a zeolite catalyst: a shaped pellet of crystals, the ZSM-5 framework of corner-sharing TO₄ tetrahedra (a live 3D model), a pore channel lined with Brønsted acid sites, and a 10-ring window where slim para-xylene slips out while bulkier ortho-xylene is held back. - [Liquid crystals: order between solid and liquid](https://www.labcanvas.com/templates/graphical-abstracts/liquid-crystals-order-between-solid-liquid): A phase spectrum of a rod-like liquid crystal: on heating, 8CB goes from crystal to smectic A, nematic and isotropic liquid, losing positional order before orientational order. - [Crystal defects that shape materials](https://www.labcanvas.com/templates/graphical-abstracts/crystal-defects-that-shape-materials): A quadrant graphical abstract of crystal defects by dimension around a live 3D edge dislocation: point defects that let atoms diffuse and dope semiconductors, dislocations that carry plastic flow, grain boundaries that strengthen by Hall–Petch, and precipitates and voids that harden alloys or start fracture. - [Memristors for brain-inspired computing: the synapse and its electronic twin](https://www.labcanvas.com/templates/graphical-abstracts/memristors-brain-inspired-computing-synapse-electronic-twin): A mirrored graphical abstract: the biological synapse on the left, the memristor on the right, and a central spine that pairs them row by row. - [Triboelectric nanogenerators: turning everyday motion into electricity](https://www.labcanvas.com/templates/graphical-abstracts/triboelectric-nanogenerators-turning-everyday-motion-into-electricity): The triboelectric nanogenerator (TENG) drawn as a four-stage cycle: two materials touch and charge, pulling them apart drives electrons through a load, they rest balanced, and pressing them together sends the electrons back, so every press and release gives a pair of opposite current pulses. - [Organic solar cells: non-fullerene acceptors climb past the fullerene ceiling](https://www.labcanvas.com/templates/graphical-abstracts/organic-solar-cells-non-fullerene-acceptors-climb-past-fullerene-ceiling): A ledger of record efficiencies for organic solar cells: fullerene acceptors stalled near 11%, while fused-ring non-fullerene acceptors (ITIC, then the crescent-shaped Y6 and its derivatives) climbed past 21%. - [Solid oxide cells: one ceramic cell, run as a fuel cell or an electrolyzer](https://www.labcanvas.com/templates/graphical-abstracts/solid-oxide-cells-ceramic-cell-run-as-fuel-cell-or-electrolyzer): A cut through a solid oxide cell from edge to edge: porous perovskite oxygen electrode, dense yttria-stabilized zirconia electrolyte and Ni–YSZ fuel electrode. - [Aqueous zinc-ion batteries: taming the zinc anode, from electrolyte to cathode](https://www.labcanvas.com/templates/graphical-abstracts/aqueous-zinc-ion-batteries-taming-zinc-anode-electrolyte-cathode): A honeycomb of twelve tiles on aqueous zinc-ion batteries: why zinc is an attractive anode in water (820 mAh g⁻¹, −0.76 V, safe), what goes wrong on it (hexagonal dendrites, hydrogen gas, corrosion and by-products), how electrolytes and interfaces fix it (additives that rebuild the Zn²⁺ water shell, water-in-salt electrolytes, a graphene template), and the MnO₂ and vanadium-oxide cathodes that host Zn²⁺. - [Photocatalyst sheets: from one SrTiO₃ particle to a 100 m² hydrogen farm](https://www.labcanvas.com/templates/graphical-abstracts/photocatalyst-sheets-srtio3-particle-100-m2-hydrogen-farm): A survey-map graphical abstract of particulate photocatalysts for overall water splitting: an aerial view of a 100 m² array of panel reactors, with map pins leading to the aluminium-doped SrTiO₃ particle (cocatalysts for hydrogen and oxygen on different facets, 96% external quantum efficiency in the UV), the photocatalyst-sheet panel, and the polyimide membrane that recovers hydrogen safely from the mixed gas. - [Making ammonia: Haber–Bosch on iron versus lithium-mediated electrosynthesis](https://www.labcanvas.com/templates/graphical-abstracts/making-ammonia-haber-bosch-iron-versus-lithium-mediated-electrosynthesis): Two roads from nitrogen to ammonia drawn as a fork that rejoins: the Haber–Bosch process on a promoted iron catalyst at about 700 K and 100 atm, fed with hydrogen from natural gas, and lithium-mediated electrochemical nitrogen reduction at room temperature and 1 bar, where plated lithium splits N₂ and a proton shuttle turns the nitride into ammonia. - [Phase-change memory: writing bits as glass or crystal](https://www.labcanvas.com/templates/graphical-abstracts/phase-change-memory-writing-bits-as-glass-or-crystal): An infinity loop for phase-change memory: a heat pulse melts and quenches Ge–Sb–Te into a high-resistance glass (RESET), a gentler one anneals it back into a low-resistance crystal (SET), and both states last at room temperature. - [Two-dimensional magnets: magnetism, one layer at a time](https://www.labcanvas.com/templates/graphical-abstracts/two-dimensional-magnets-magnetism-layer-at-time): A staircase of CrI₃ stacks: a single layer is an Ising ferromagnet, two layers make a layered antiferromagnet that a gate can flip, four layers between graphene filter spins with a record tunnelling magnetoresistance, and the bulk is a ferromagnet again. - [Topological insulators: insulating inside, conducting at the edge](https://www.labcanvas.com/templates/graphical-abstracts/topological-insulators-insulating-inside-conducting-at-edge): The figure is the insulator: its frame is a two-lane edge channel where spin-up and spin-down electrons travel in opposite directions, while inside a quintuple-layer slab of Bi₂Se₃, a surface Dirac cone crossing the bulk gap (live 3D) and spin–momentum locking explain why the surface conducts and resists backscattering. - [Ferroelectric hafnium oxide: a polar phase in a chip dielectric](https://www.labcanvas.com/templates/graphical-abstracts/ferroelectric-hafnium-oxide-polar-phase-chip-dielectric): An energy landscape for ferroelectric HfO₂: a double well whose two minima are the two polarization states and whose barrier an electric field pushes the film over. - [MRAM: a bit stored in the spins of a tunnel junction](https://www.labcanvas.com/templates/graphical-abstracts/mram-bit-stored-spins-tunnel-junction): The layers of a CoFeB/MgO magnetic tunnel junction run across the figure as bands: with parallel magnetizations electrons tunnel easily (low resistance), a spin-polarized current writes the bit by spin-transfer torque, and antiparallel magnetizations block tunnelling (high resistance). - [Shape-memory alloys: NiTi switches between austenite and martensite](https://www.labcanvas.com/templates/graphical-abstracts/shape-memory-alloys-niti-switches-between-austenite-martensite): A triangle cycle for nickel–titanium: cooled, the cubic austenite turns into twinned martensite without changing shape; loaded, the twins reorient and the wire bends; heated above Af, the alloy returns to austenite and to its remembered shape. - [Mechanical metamaterials: properties from geometry, not chemistry](https://www.labcanvas.com/templates/graphical-abstracts/mechanical-metamaterials-properties-geometry-not-chemistry): An engineering drawing sheet for architected materials: two specimens of the same solid, one a regular honeycomb that thins when pulled and one a re-entrant honeycomb that widens (a negative Poisson’s ratio), a ruler of Poisson’s ratio from +0.5 to −1 with the cells that reach it, and a 3D strut lattice whose members stretch instead of bending, keeping its stiffness per unit mass over three orders of magnitude in density. - [Structural colour: photonic crystals colour without dyes](https://www.labcanvas.com/templates/graphical-abstracts/structural-colour-photonic-crystals-colour-without-dyes): A fan of light: white light falls on an opal of close-packed spheres and one colour comes back, set by the spacing of the spheres through Bragg reflection, blue for small spheres and red for large ones. - [Transparent wood: take out the lignin, fill in a matching polymer](https://www.labcanvas.com/templates/graphical-abstracts/transparent-wood-take-out-lignin-fill-matching-polymer): A staircase of four wood blocks: natural wood, the white cellulose template left when the light-absorbing lignin is removed, the template filled with a polymer whose refractive index matches the cell walls, and transparent wood that passes up to 90 % of the light. - [Superhydrophobic surfaces: the lotus effect, read on a protractor](https://www.labcanvas.com/templates/graphical-abstracts/superhydrophobic-surfaces-lotus-effect-read-protractor): A contact-angle protractor from 0° to 180°: water spreads below 90°, beads above it, and beyond 150° (with drops sliding off below 5°) the surface is superhydrophobic, like the lotus leaf at 163°. - [Direct lithium extraction: picking Li⁺ out of brine](https://www.labcanvas.com/templates/graphical-abstracts/direct-lithium-extraction-picking-li-out-brine): An ion Sankey: every ion in a salar brine is a ribbon, and two gates sort them. - [Breaking forever chemicals: four ways to cleave the C–F bond](https://www.labcanvas.com/templates/graphical-abstracts/breaking-forever-chemicals-four-ways-cleave-c-f-bond): A PFOA molecule laid out like a labelled specimen: the strongest single bond in organic chemistry in a sheath of fluorine. - [Enzymatic PET recycling: the right enzyme at the right temperature](https://www.labcanvas.com/templates/graphical-abstracts/enzymatic-pet-recycling-right-enzyme-at-right-temperature): A thermometer from 30 to 80 °C is the spine: PET hydrolases hang off it at the temperatures they work at, from the bacterium that lives on PET at 30 °C to an engineered cutinase in the narrow window just above the glass transition. - [Electrochromic smart windows: glass that tints on demand](https://www.labcanvas.com/templates/graphical-abstracts/electrochromic-smart-windows-glass-that-tints-demand): An architect’s elevation: a facade whose windows tint from clear to tungsten-bronze blue, and a section through one pane, bleached and coloured, where Li⁺ and electrons move from a nickel oxide counter electrode into tungsten oxide and turn it blue. - [Low-carbon cement: less clinker, and CO₂ back into the concrete](https://www.labcanvas.com/templates/graphical-abstracts/low-carbon-cement-less-clinker-co2-back-into-concrete): A cement works in elevation: the kiln where limestone gives off its own CO₂ as it turns to lime, beside the CO₂ of the fuel. - [How the zebrafish heart rebuilds itself](https://www.labcanvas.com/templates/graphical-abstracts/how-zebrafish-heart-rebuilds-itself): A recovery-curve graphical abstract: after losing part of its ventricle, the zebrafish heart climbs back to whole muscle over about two months. - [The Drosophila circadian clock](https://www.labcanvas.com/templates/graphical-abstracts/drosophila-circadian-clock): A clock-dial graphical abstract of the Drosophila molecular clock: the CLOCK–CYCLE activator switches on period and timeless at dawn, PER and TIM proteins build through the day and cross into the nucleus to shut their own genes off at night, and the ~24 h loop restarts. - [Bacteriophages against biofilms](https://www.labcanvas.com/templates/graphical-abstracts/bacteriophages-against-biofilms): A cutaway graphical abstract: a biofilm in cross-section, read left to right as phages break a bacterial stronghold. - [CRISPR diagnostics: find a sequence, light a signal](https://www.labcanvas.com/templates/graphical-abstracts/crispr-diagnostics-find-sequence-light-signal): A test-strip graphical abstract of CRISPR diagnostics. - [Cell-free protein synthesis: DNA in, protein out](https://www.labcanvas.com/templates/graphical-abstracts/cell-free-protein-synthesis-dna-protein-out): A pipeline graphical abstract of cell-free protein synthesis. - [Hydrogen embrittlement of steels: trap the hydrogen before it finds the crack](https://www.labcanvas.com/templates/graphical-abstracts/hydrogen-embrittlement-steels-trap-hydrogen-before-it-finds-crack): A tensile specimen cut open to its grains and read as the path of one hydrogen atom: H₂ splits at the surface, the atoms hop between tetrahedral sites of the iron lattice, defects hold some back, fine carbides lock them away and, where hydrogen gets through, a crack opens. - [Chemically strengthened glass: a log of the ion-exchanged surface](https://www.labcanvas.com/templates/graphical-abstracts/chemically-strengthened-glass-log-ion-exchanged-surface): A well log of an ion-exchanged glass, read from the surface down: in molten KNO₃, larger K⁺ ions replace Na⁺, so the surface is squeezed into compression (up to about 1000 MPa) that falls to zero at the depth of layer, balanced by a small tension in the core. - [Bulk metallic glasses: outrun the crystal](https://www.labcanvas.com/templates/graphical-abstracts/bulk-metallic-glasses-outrun-crystal): A time–temperature–transformation chart as the whole figure: a metal melt becomes a glass only if its cooling curve misses the crystallization nose. - [Electronic skin: soft sensors that stretch, press and feel](https://www.labcanvas.com/templates/graphical-abstracts/electronic-skin-soft-sensors-that-stretch-press-feel): Stretchable electronic skin drawn as its own circuit: rigid islands joined by gold serpentine bridges, read in order. - [Lead-free piezoceramics: a family tree that grows d₃₃](https://www.labcanvas.com/templates/graphical-abstracts/lead-free-piezoceramics-family-tree-that-grows-d33): A family tree of lead-free piezoelectric ceramics rooted in PZT (more than 60 wt % lead) and the perovskite skeleton all candidates share. - [Quantum sensing with NV centres: one defect in diamond, read by light](https://www.labcanvas.com/templates/graphical-abstracts/quantum-sensing-nv-centres-defect-diamond-read-light): A nitrogen–vacancy centre in diamond holds an electron spin that green light sets and red fluorescence reads. - [Upconversion nanoparticles: two infrared photons in, one visible photon out](https://www.labcanvas.com/templates/graphical-abstracts/upconversion-nanoparticles-two-infrared-photons-visible-photon-out): Lanthanide upconversion written as a sum: two near-infrared photons absorbed by ytterbium ions in a NaYF₄ core are relayed to erbium, which emits one visible photon. - [Molecular solar thermal storage: sunlight kept as strain, released as heat](https://www.labcanvas.com/templates/graphical-abstracts/molecular-solar-thermal-storage-sunlight-kept-as-strain-released-as-heat): A photoswitch charged by sunlight keeps the energy as the strain of a high-energy isomer: norbornadiene becomes quadricyclane, which can be stored for days to years and turned back by a catalyst to release heat. - [Gallium liquid metals: a metal you can pour, print and stretch](https://www.labcanvas.com/templates/graphical-abstracts/gallium-liquid-metals-metal-you-can-pour-print-stretch): Gallium alloys such as EGaIn and Galinstan are liquid near room temperature yet conduct like metals. - [Atomic layer deposition: building a film one layer per cycle](https://www.labcanvas.com/templates/graphical-abstracts/atomic-layer-deposition-building-film-layer-per-cycle): Atomic layer deposition of alumina drawn as a coil, one turn per cycle: a trimethylaluminium pulse, a purge, a water pulse and a purge, each half-reaction stopping by itself, so every cycle adds the same sub-monolayer. ### Drug discovery & proteins - [AlphaFold: a predicted structure and how sure it is](https://www.labcanvas.com/templates/drug-discovery/alphafold-predicted-structure-how-sure-it-is): From a sequence and its alignment to a 3D model coloured by confidence: per-residue pLDDT, the predicted aligned error between domains, and AlphaFold 3 complexes with ligands. - [Inside AlphaFold 2 and AlphaFold 3](https://www.labcanvas.com/templates/drug-discovery/inside-alphafold-2-alphafold-3): The two architectures side by side: AlphaFold 2 refines an MSA and a pair representation through 48 Evoformer blocks and builds the chain with a structure module; AlphaFold 3 keeps a lighter 4-block MSA module, 48 Pairformer blocks and generates atom coordinates with a diffusion module, for complexes of proteins, nucleic acids, small molecules and ions. - [Protein folding: the energy landscape](https://www.labcanvas.com/templates/drug-discovery/protein-folding-energy-landscape): Why a chain finds its fold: a random search would take forever (Levinthal), but the energy landscape is a funnel with many downhill routes to one native state, the free-energy minimum that the sequence sets (Anfinsen). - [From coevolution to protein language models](https://www.labcanvas.com/templates/drug-discovery/coevolution-protein-language-models): Residues in contact mutate together, so an alignment holds the fold (direct-coupling analysis). ### Nanomaterial applications - [Nanomaterials for energy storage](https://www.labcanvas.com/templates/nanomaterial-applications/nanomaterials-energy-storage-batteries-supercapacitors): A poster-style graphical abstract on why nanostructuring helps batteries and supercapacitors: shorter Li⁺ diffusion paths, more surface, strain accommodation and surface redox, then a 0D to 3D toolbox (Si@C yolk–shell particles, CNTs and Si nanowires, MXene and graphene sheets, MOFs). - [Targeted drug delivery with nanoparticles](https://www.labcanvas.com/templates/nanomaterial-applications/targeted-drug-delivery-nanoparticles): A 3D-style graphical abstract of nanoparticle drug delivery: the anatomy of a multifunctional liposomal carrier (targeting ligands, PEG corona, bilayer, drug payloads, imaging agent), passive tumour targeting through the EPR effect, and active targeting with receptor-mediated endocytosis and triggered drug release. ## Materials: MOFs, COFs, 2D materials, perovskites, battery materials and zeolites - [Metal–organic frameworks (MOFs): structure, synthesis and uses](https://www.labcanvas.com/mof): Metal–organic frameworks (MOFs) are crystalline, porous materials in which metal ions or metal–oxygen clusters are joined by organic linkers through coordination bonds into an open, periodic network. MOF-5, Zn₄O(terephthalate)₃, reported by Li, Eddaoudi, O’Keeffe and Yaghi in Nature in 1999, stays crystalline when its pores are emptied and reaches a BET surface area of about 3,800 m² g⁻¹ (Li et al. 1999; Kaye et al. 2007). Because the metal node and the linker can be chosen separately, MOFs with pores from a few ångströms to over 3 nm, open metal sites and high water stability have been made, and they are studied for gas storage, CO₂ capture, separations, catalysis and drug delivery. - [MOF-5 (IRMOF-1): structure, synthesis and properties](https://www.labcanvas.com/mof/mof-5): MOF-5, also called IRMOF-1, is the prototypical metal–organic framework, Zn₄O(BDC)₃: octahedral Zn₄O(CO₂)₆ clusters joined by terephthalate (1,4-benzenedicarboxylate, BDC) linkers into a cubic net with cavities about 12 and 15 Å across. First reported by Li, Eddaoudi, O’Keeffe and Yaghi in Nature in 1999, it stays crystalline when its pores are emptied and heated to 300 °C, and with careful air-free handling reaches a BET surface area of about 3,800 m² g⁻¹. - [ZIF-8: structure, synthesis and properties](https://www.labcanvas.com/mof/zif-8): ZIF-8 is a zeolitic imidazolate framework, Zn(mIm)₂: single tetrahedral Zn²⁺ ions joined by 2-methylimidazolate (mIm⁻) linkers into a sodalite (sod) net, with cages 11.6 Å across connected by windows 3.4 Å wide. First reported by Park, Yaghi and co-workers in PNAS in 2006, it has a Langmuir surface area of 1,810 m² g⁻¹, is stable up to 550 °C, and resists boiling water, organic solvents and hot aqueous sodium hydroxide. - [HKUST-1 (Cu-BTC): structure, synthesis and properties](https://www.labcanvas.com/mof/hkust-1): HKUST-1, also called Cu-BTC or MOF-199, is a copper metal–organic framework, Cu₃(BTC)₂: pairs of Cu²⁺ ions bridged by four carboxylates (paddlewheels) joined by trimesate (benzene-1,3,5-tricarboxylate, BTC) linkers into a cubic framework with 1 nm channels. First reported by Chui, Lo, Charmant, Orpen and Williams in Science in 1999 as [Cu₃(TMA)₂(H₂O)₃]ₙ, it is stable up to 240 °C, and removing the water bound to each copper leaves open metal sites that bind guest molecules. - [UiO-66: structure, synthesis and properties](https://www.labcanvas.com/mof/uio-66): UiO-66 is a zirconium metal–organic framework, Zr₆O₄(OH)₄(BDC)₆: octahedral Zr₆O₄(OH)₄ clusters, each joined to twelve neighbours by terephthalate (1,4-benzenedicarboxylate, BDC) linkers in a face-centred cubic (fcu) net. First reported by Cavka, Lillerud and co-workers at the University of Oslo in JACS in 2008, it decomposes only above 500 °C, resists most chemicals and stays crystalline under 10 tons/cm² of pressure, making it the prototypical zirconium MOF. - [MIL-101(Cr): structure, pore size, synthesis and uses](https://www.labcanvas.com/mof/mil-101): MIL-101(Cr) is a chromium terephthalate metal–organic framework, Cr₃F(H₂O)₂O(BDC)₃·nH₂O: trimers of CrO₆ octahedra joined by terephthalate (BDC) linkers into supertetrahedra, which share corners like the tetrahedra of a zeolite (MTN topology). First reported by Férey and co-workers in Science in 2005, it has a giant cubic cell of about 702,000 ų, mesoporous cages about 30 and 34 Å across and a Langmuir surface area near 5,900 m² g⁻¹. - [MOF-74 (CPO-27): structure, synthesis and CO₂ capture](https://www.labcanvas.com/mof/mof-74): MOF-74, also called CPO-27 or M₂(dobdc), is a family of metal–organic frameworks in which helical chains of metal ions are joined by 2,5-dioxidoterephthalate (dobdc⁴⁻) into a honeycomb of one-dimensional hexagonal channels. The zinc compound, Zn₂(dobdc), was first reported as MOF-74 by Rosi, Yaghi and co-workers in JACS in 2005; once the solvent is removed, every metal leaves an open site facing the channel, which is why the magnesium member, Mg-MOF-74, is a benchmark CO₂ adsorbent. - [Covalent organic frameworks (COFs): structure, linkages and uses](https://www.labcanvas.com/cof): Covalent organic frameworks (COFs) are crystalline, porous solids made only of light elements, in which organic building blocks are joined by strong covalent bonds into periodic two- or three-dimensional frameworks (Côté et al. 2005; Diercks and Yaghi 2017). The first two, COF-1 and COF-5, were reported by Yaghi and co-workers in Science in 2005; they are made by reversible condensation reactions, such as boronic acids closing boroxine or boronate ester rings, which let the growing solid correct its errors and crystallise (Côté et al. 2005). Their pores, from about 7 Å to 27 Å in the classic examples, are set by the size and shape of the building blocks. - [COF-5: structure, synthesis and properties](https://www.labcanvas.com/cof/cof-5): COF-5 is one of the two first covalent organic frameworks, C₉H₄BO₂: hexahydroxytriphenylene (HHTP) and benzene-1,4-diboronic acid (BDBA) joined by five-membered boronate ester rings into flat honeycomb layers. Reported by Côté, Benin, Ockwig, O’Keeffe, Matzger and Yaghi in Science in 2005, its layers stack eclipsed (P6/mmm), leaving hexagonal channels 27 Å across; it has a surface area of 1,590 m² g⁻¹ and is thermally stable to 500–600 °C. - [COF-1: the first covalent organic framework](https://www.labcanvas.com/cof/cof-1): COF-1 is the first covalent organic framework, C₃H₂BO: benzene-1,4-diboronic acid (BDBA) condenses with itself, three boronic acids closing each flat six-membered boroxine (B₃O₃) ring, into honeycomb layers. Reported by Côté, Benin, Ockwig, O’Keeffe, Matzger and Yaghi in Science in 2005, its layers stack staggered (P6₃/mmc), leaving pores of about 7 Å; it has a surface area of 711 m² g⁻¹ and is thermally stable to 500–600 °C. - [TpPa-1: the acid-stable β-ketoenamine COF](https://www.labcanvas.com/cof/tppa-1): TpPa-1 is a two-dimensional covalent organic framework made from 1,3,5-triformylphloroglucinol (Tp) and p-phenylenediamine (Pa-1), repeat unit C₁₈H₁₂N₃O₃. The Schiff base condensation first gives an enol-imine, which tautomerizes irreversibly to a β-ketoenamine, so no hydrolysable imine bond remains. Reported by Kandambeth, Mallick, Lukose, Mane, Heine and Banerjee in J. Am. Chem. Soc. in 2012, it stays crystalline in 9 N hydrochloric acid and boiling water. - [COF-300: the first imine-linked 3D covalent organic framework](https://www.labcanvas.com/cof/cof-300): COF-300 is a three-dimensional covalent organic framework made from tetrahedral tetra-(4-anilyl)methane and linear terephthaldehyde joined by imine (C=N) bonds, repeat unit C₄₁H₂₈N₄. Reported by Uribe-Romo, Hunt, Furukawa, Klöck, O’Keeffe and Yaghi in J. Am. Chem. Soc. in 2009, it consists of five interwoven diamond nets, yet keeps pores 7.2 Å across, a surface area of 1,360 m² g⁻¹ and thermal stability up to 490 °C. - [2D materials: graphene, h-BN, MoS₂, MXenes and beyond](https://www.labcanvas.com/2d-materials): Two-dimensional (2D) materials are crystals only one or a few atoms thick: single layers of graphene, hexagonal boron nitride (h-BN), molybdenum disulfide (MoS₂), MXenes and many others. Most are peeled or etched from layered bulk crystals, whose layers are strongly bonded within the plane but only weakly bonded to each other. Graphene, a zero-gap semimetal, was isolated with adhesive tape by Novoselov, Geim and co-workers in 2004, and h-BN, a wide-gap insulator, and MoS₂, a semiconductor with a 1.8 eV direct gap as a monolayer, followed (Novoselov et al. 2004; Novoselov et al. 2005; Cassabois et al. 2016; Mak et al. 2010). Stacked in a chosen order they form van der Waals heterostructures (Geim and Grigorieva 2013). - [Graphene: structure, properties and synthesis](https://www.labcanvas.com/2d-materials/graphene): Graphene is a single layer of carbon atoms, one atom thick, bonded in a flat honeycomb lattice: each sp² carbon joined to three neighbours 1.42 Å away, two atoms per hexagonal cell with a = 2.46 Å. Stacked, graphene sheets make graphite. It was first isolated by peeling graphite with adhesive tape and measured by Novoselov, Geim and co-workers in Science in 2004, who found a two-dimensional semimetal, stable in air, with room-temperature mobilities of about 10,000 cm² V⁻¹ s⁻¹. - [Graphene oxide (GO): structure, synthesis and properties](https://www.labcanvas.com/2d-materials/graphene-oxide): Graphene oxide (GO) is a single layer of graphite oxide: a graphene sheet carrying epoxide (C–O–C) and hydroxyl (C–OH) groups on both faces and carboxyl and carbonyl groups at its edges, the structure described by the Lerf–Klinowski model (1998). It has no fixed formula. Graphite oxide was first made by Brodie in 1859; GO is usually made by oxidising graphite with KMnO₄ in concentrated sulfuric acid (the Hummers method, 1958) and splitting the product into single sheets in water, and it can be reduced back towards graphene as reduced graphene oxide (rGO). - [Hexagonal boron nitride (h-BN): structure, band gap and uses](https://www.labcanvas.com/2d-materials/h-bn): Hexagonal boron nitride (h-BN) is a layered crystal of boron and nitrogen, BN, built from flat honeycomb sheets like graphene’s but with boron and nitrogen atoms alternating, which makes it an electrical insulator with a wide band gap (an indirect gap of 5.955 eV). Single layers were among the first two-dimensional crystals peeled from bulk crystals (Novoselov et al., PNAS 2005), and since Dean et al. showed in 2010 that graphene on h-BN has mobilities almost an order of magnitude better than on SiO₂, h-BN has been the standard substrate and encapsulating layer for 2D electronics. - [MoS₂ (molybdenum disulfide): structure, band gap and uses](https://www.labcanvas.com/2d-materials/mos2): Molybdenum disulfide (MoS₂) is a layered transition metal dichalcogenide: each layer is a sandwich of molybdenum atoms between two sheets of sulfur (S–Mo–S), and in the common 2H form the layers repeat every 6.15 Å. Bulk MoS₂, the mineral molybdenite, is an indirect-gap semiconductor; thinned to one layer it becomes a direct-gap semiconductor that emits light strongly, as Mak et al. and Splendiani et al. reported in 2010. Its 1.8 eV gap let Radisavljevic et al. build single-layer MoS₂ transistors in 2011 with on/off ratios of 10⁸. - [MXene (Ti₃C₂Tₓ): structure, synthesis and properties](https://www.labcanvas.com/2d-materials/mxene): MXenes are two-dimensional transition metal carbides and nitrides made by etching the A-element layers out of layered MAX phases; the first was titanium carbide, Ti₃C₂Tₓ, in which Tₓ stands for the –O, –OH and –F groups that cover both faces of each Ti–C–Ti–C–Ti layer. Naguib, Barsoum, Gogotsi and co-workers made it in 2011 (Advanced Materials) by etching the aluminium out of Ti₃AlC₂ with hydrofluoric acid at room temperature, and in 2012 named the family “MXenes” to denote the loss of the A element and their structural similarity to graphene. Ti₃C₂Tₓ is a metallic conductor with a hydrophilic surface, so it can be processed in water into conductive films. - [Twisted bilayer graphene: the magic angle and moiré superlattices](https://www.labcanvas.com/2d-materials/twisted-bilayer-graphene): Twisted bilayer graphene (TBG) is two sheets of graphene stacked with one turned by a small angle θ, so that their honeycombs form a moiré pattern of AA, AB and BA stacking regions repeating every L = a / (2 sin(θ/2)), about 12.8 nm at 1.1°. Bistritzer and MacDonald predicted in PNAS in 2011 that at a set of “magic” angles the electrons’ velocity vanishes and the lowest bands become flat; in 2018 Cao, Jarillo-Herrero and co-workers found that bilayers twisted to about 1.1°, the first magic angle, show correlated insulating states and superconductivity up to 1.7 K (Nature 556, 43 and 80). - [Perovskite structure (ABX₃): octahedra, tolerance factor and tilts](https://www.labcanvas.com/perovskites): A perovskite is any ABX₃ compound built from a network of corner-sharing BX₆ octahedra with a larger A cation in the cavities between them: B is 6-fold and A 12-fold coordinated by the anion X, which is usually oxygen or a halogen (Bartel et al. 2019). Whether a composition adopts this structure has been estimated for over 90 years with the Goldschmidt tolerance factor, which compares the sizes of the three ions (Bartel et al. 2019). Oxide perovskites such as SrTiO₃ and BaTiO₃ are classic dielectrics and ferroelectrics; halide perovskites such as CH₃NH₃PbI₃, first used in solar cells by Kojima et al. in 2009, have since reached solar-cell efficiencies above 18% (Jeon et al. 2015) and light-emission quantum yields up to 90% (Protesescu et al. 2015). - [SrTiO₃ (strontium titanate): structure, properties and uses](https://www.labcanvas.com/perovskites/srtio3): Strontium titanate (SrTiO₃) is an oxide perovskite: at room temperature it is cubic with a = 3.905 Å, with Ti in corner-sharing TiO₆ octahedra and Sr in the cavities between them (Leroy et al. 2025; Bartel et al. 2019). Below about 105 K the octahedra rotate and the crystal turns tetragonal, and on further cooling it comes close to ferroelectricity but never gets there: quantum fluctuations keep it paraelectric down to the lowest temperatures (Leroy et al. 2025). It is a substrate for oxide films (Kawasaki et al. 1994), home of the high-mobility LaAlO₃/SrTiO₃ interface (Ohtomo & Hwang 2004), and in Al-doped form a photocatalyst that splits water with a quantum efficiency near unity (Takata et al. 2020). - [BaTiO₃ (barium titanate): structure, phase transitions and uses](https://www.labcanvas.com/perovskites/batio3): Barium titanate (BaTiO₃) is the classic ferroelectric perovskite: titanium sits in corner-sharing TiO₆ octahedra and barium in the cavities between them (Tan et al. 2015). Above its Curie point near 120 °C it is cubic and paraelectric (Tan et al. 2015; Bai et al. 2013); below it the titanium shifts along the c axis and the crystal becomes tetragonal and spontaneously polarized (Tan et al. 2015; Swaminathan et al. 2010), and at lower temperatures it passes through orthorhombic and rhombohedral ferroelectric phases (Shao & Zuo 2017). It is the main raw material of multilayer ceramic capacitors (Dai et al. 2022), and BaTiO₃-based ceramics are leading lead-free piezoelectrics (Liu & Ren 2009). - [CsPbBr₃ (caesium lead bromide): structure, nanocrystals and uses](https://www.labcanvas.com/perovskites/cspbbr3): Caesium lead bromide (CsPbBr₃) is an all-inorganic halide perovskite: a framework of corner-sharing PbBr₆ octahedra with Cs⁺ ions in the cavities between them. In bulk it is orthorhombic at room temperature, turning tetragonal at about 88 °C and cubic at about 130 °C, with a band gap of about 2.3 eV (He et al. 2018). As colloidal CsPbX₃ (X = Cl, Br, I) nanocrystals, first made by hot injection by Protesescu et al. in 2015, it emits bright, narrow light tunable across the visible from 410 to 700 nm. - [MAPbI₃ (methylammonium lead iodide): structure, band gap and solar cells](https://www.labcanvas.com/perovskites/mapbi3): Methylammonium lead iodide (CH₃NH₃PbI₃, MAPbI₃) is a hybrid organic–inorganic halide perovskite: corner-sharing PbI₆ octahedra with methylammonium cations in the cavities. It is tetragonal at room temperature, cubic above about 327–330 K and orthorhombic below about 160–165 K, and absorbs light with a direct band gap of about 1.5 eV (Whitfield et al. 2016; Deretzis & La Magna 2017; Kim et al. 2012). Kojima et al. first used it in a solar cell in 2009, reaching 3.8% efficiency, and solid-state cells followed in 2012 (Kim et al. 2012; Lee et al. 2012). - [FAPbI₃ (formamidinium lead iodide): phases, band gap and solar cells](https://www.labcanvas.com/perovskites/fapbi3): Formamidinium lead iodide, HC(NH₂)₂PbI₃ (FAPbI₃), is a hybrid halide perovskite with formamidinium on the A site (Stoumpos et al. 2013); its black α-phase is cubic (Jeong et al. 2021). Its band gap of 1.48 eV is narrower than the 1.55 eV of methylammonium lead iodide (Zheng et al. 2022), and FAPbI₃-based cells passed 20% in 2015 (Yang et al. 2015). Pure FAPbI₃ can also crystallise as a yellow, hexagonal, non-perovskite δ-phase, so most high-efficiency cells stabilise the black phase by mixing in other cations or anions (Jeon et al. 2015; Saliba et al. 2016). - [2D (layered) halide perovskites: Ruddlesden–Popper, Dion–Jacobson and the n value](https://www.labcanvas.com/perovskites/2d-perovskites): Two-dimensional (2D), or layered, halide perovskites are slabs of corner-sharing lead halide octahedra, n layers thick, separated by bulky organic spacer cations; in the Ruddlesden–Popper series (BA)₂(MA)ₙ₋₁PbₙI₃ₙ₊₁ the band gap falls from 2.24 eV at n = 1 towards the 1.52 eV of MAPbI₃ as n grows (Cao et al. 2015). Each slab acts as a natural quantum well holding tightly bound excitons (Blancon et al. 2018). In 2014 Smith et al. used the phenethylammonium phase (PEA)₂(MA)₂Pb₃I₁₀ as a more moisture-resistant solar absorber, and in 2016 Tsai et al. raised layered perovskite cells to 12.52%. - [Battery materials: how a lithium-ion cell works and what it is made of](https://www.labcanvas.com/battery-materials): A lithium-ion battery stores energy in two electrodes, a cathode such as LiCoO₂ and an anode such as graphite (LiC₆), separated by an electrolyte that lets Li⁺ ions through but forces the electrons round the external circuit (Goodenough & Park 2013). On charge, Li⁺ leaves the cathode host and enters the anode; on discharge it goes back (Lin et al. 2026). The practical cathodes are layered oxides (LiCoO₂, NMC), spinels (LiMn₂O₄) and polyanion compounds (olivine LiFePO₄), all from Goodenough’s group in the 1980s and 1990s (Manthiram 2020), while research pushes towards silicon and lithium-metal anodes, solid electrolytes and sodium-ion cells. - [LiCoO₂ (lithium cobalt oxide): structure, capacity and uses](https://www.labcanvas.com/battery-materials/licoo2): Lithium cobalt oxide (LiCoO₂, LCO) is a layered oxide in which lithium and cobalt ions sit on alternate planes between close-packed oxygen layers, so Li⁺ can slide in and out of the CoO₂ sheets at about 4 V versus lithium (Manthiram 2020). Found in Goodenough’s group in the 1980s and paired with graphite by Sony in 1991, it was the cathode of the first commercial lithium-ion batteries (Manthiram 2020). Only about half of its lithium is used in classic cells charged to 4.2 V, about 140 of the theoretical 274 mAh g⁻¹, which is why high-voltage LCO for phones and laptops is an active research field (Lin et al. 2026). - [NMC (LiNiₓMnᵧCo₁₋ₓ₋ᵧO₂): structure, nickel content and stability](https://www.labcanvas.com/battery-materials/nmc): NMC, lithium nickel manganese cobalt oxide LiNiₓMnᵧCo₁₋ₓ₋ᵧO₂ (nickel, manganese and cobalt fractions adding up to 1), is a layered cathode with the same α-NaFeO₂-type R-3m structure as LiCoO₂, in which nickel, manganese and cobalt share the transition-metal layer (Hashem et al. 2019). Nickel carries most of the capacity, Mn⁴⁺ stabilizes the structure and cobalt limits Li/Ni mixing; NMC111 (LiNi₁/₃Mn₁/₃Co₁/₃O₂) gives about 200 mAh g⁻¹ between 2.8 and 4.6 V (Hashem et al. 2019). Raising nickel towards NMC811 increases capacity and lowers cost but makes the cathode less stable through cracking, oxygen loss and surface reconstruction (Manthiram 2020; Liao et al. 2022), and nickel-rich NMC now powers millions of electric vehicles (Lu et al. 2024). - [LiFePO₄ (LFP): olivine structure, voltage and uses](https://www.labcanvas.com/battery-materials/lifepo4): Lithium iron phosphate (LiFePO₄, LFP) is an olivine-structured cathode for lithium-ion batteries with a theoretical capacity of 170 mAh g⁻¹ at 3.4 V (Yin et al. 2026). On charging it converts to FePO₄ through a first-order two-phase transition at about 3.4 V vs Li/Li⁺, which is why its voltage curve is so flat, and lithium moves only along one-dimensional channels in the crystal (Boesenberg et al. 2013). Its poor electronic conductivity is overcome with small, carbon-coated particles, and its strong P–O bonds make it thermally stable and cobalt-free, so it now powers many electric vehicles and grid storage systems (Liu et al. 2026; Yin et al. 2026). - [LiMn₂O₄ (LMO): spinel structure, voltage and capacity fade](https://www.labcanvas.com/battery-materials/limn2o4): Lithium manganese oxide (LiMn₂O₄, LMO) is a spinel cathode for lithium-ion batteries: a cubic crystal (space group Fd-3m) with lithium on tetrahedral 8a sites and manganese on octahedral 16d sites, giving a theoretical capacity of about 148 mAh g⁻¹ and two voltage plateaus near 4.1 V (Bakierska et al. 2016). Its three-dimensional lithium diffusion network gives it good rate capability for high-power cells, and manganese is cheap, abundant and less toxic than cobalt (Liu et al. 2026). Its weakness is capacity fade, caused by the Jahn–Teller distortion of Mn³⁺ and by manganese dissolving into the electrolyte (Bakierska et al. 2016); replacing a quarter of the Mn with Ni gives the 4.7 V spinel LiNi₀.₅Mn₁.₅O₄ (Zhang et al. 2025). - [Graphite anode: LiC₆, capacity, staging, SEI and lithium plating](https://www.labcanvas.com/battery-materials/graphite-anode): Graphite is the dominant anode of lithium-ion batteries: on charging, lithium ions slide between its carbon layers until the fully lithiated compound LiC₆ is reached, which corresponds to a theoretical capacity of about 372 mAh g⁻¹ (Wu et al. 2026). It operates at about 0.1 V vs Li/Li⁺ (Clark et al. 2016), passing through a series of staging transitions on the way to LiC₆ (Chen et al. 2025). Its low potential gives cells a high voltage but also two characteristic problems: the electrolyte is reduced on its surface to form the solid electrolyte interphase (SEI), and at fast charging or low temperature lithium can plate as metal instead of intercalating (Chen et al. 2025). - [Silicon anode: capacity, volume expansion and how it is tamed](https://www.labcanvas.com/battery-materials/silicon-anode): Silicon stores lithium by alloying, not intercalation: fully lithiated to Li₁₅Si₄ (3.75 Li per Si) it holds 3,579 mAh g⁻¹, more than nine times graphite, and 4,200 mAh g⁻¹ is quoted for Li₂₂Si₅ (Nepal & Dhakal 2026; Kawaura et al. 2023; Chamidah et al. 2023). The price is a volume change of about 300% that cracks particles and keeps breaking the solid electrolyte interphase (SEI) (Liu et al. 2014). Nanowires (Chan et al. 2008), sub-150 nm particles, yolk–shell carbon cages, SiOₓ and silicon–graphite blends are the main ways the swelling is managed. - [Solid electrolytes: garnet LLZO, argyrodite Li₆PS₅Cl and LGPS](https://www.labcanvas.com/battery-materials/solid-electrolytes): A solid electrolyte conducts lithium ions through a solid, replacing the flammable liquid of a lithium-ion cell and opening the way to lithium metal anodes (Lee et al. 2024). The two leading inorganic families are oxide garnets such as cubic Li₇La₃Zr₂O₁₂ (LLZO), stable against lithium and reaching about 0.2–1.5 mS cm⁻¹ when doped with Al, Ga or Ta (Wu et al. 2017; Tong et al. 2015; Fukuda et al. 2025), and soft sulfides such as argyrodite Li₆PS₅Cl (~10 mS cm⁻¹) and Li₁₀GeP₂S₁₂, whose 12 mS cm⁻¹ beat liquid electrolytes (Kim et al. 2026; Kamaya et al. 2011). Their weak points are interfaces and lithium dendrites. - [Sodium-ion battery materials: hard carbon, Prussian blue and layered oxides](https://www.labcanvas.com/battery-materials/sodium-ion): A sodium-ion battery works like a lithium-ion battery, rocking Na⁺ between two hosts, but sodium makes up about 2.65% of the Earth’s crust against about 0.0065% for lithium (Li P. et al. 2026). Because Na⁺ (0.102 nm) is larger than Li⁺ (0.076 nm), graphite stores almost no sodium (<35 mAh g⁻¹), so the anode is hard carbon with 300–400 mAh g⁻¹ (Zhou & Shen 2025). Cathodes come in three families: layered oxides, Prussian blue analogues and polyanions such as Na₄Fe₃(PO₄)₂P₂O₇ (Shen Q. et al. 2026); the cells trade some energy density for cost, low-temperature performance and safety. - [Zeolites: structure, framework types and uses](https://www.labcanvas.com/zeolites): Zeolites are crystalline microporous aluminosilicates built from corner-sharing TO₄ tetrahedra (T = Si, Al) that enclose channels and cages with openings typically below 2 nm (Li J. et al. 2022). Every Al that replaces Si leaves one negative charge on the framework, balanced by a cation; when that cation is a proton the site is a strong Brønsted acid (Li J. et al. 2022). More than 250 framework types are known, each with a three-letter code from the International Zeolite Association such as MFI, FAU, LTA and CHA, and zeolites are used as cracking catalysts, adsorbents, ion exchangers and NOₓ-removal catalysts (Li J. et al. 2022; Vogt and Weckhuysen 2015; Shan et al. 2021). - [ZSM-5 (MFI): structure, channels and uses](https://www.labcanvas.com/zeolites/zsm-5): ZSM-5 is a high-silica zeolite with the MFI framework: two sets of intersecting 10-ring channels, straight channels of 5.3 × 5.6 Å crossed by sinusoidal (zig-zag) channels, all 5.1–5.6 Å across (Feng Z. et al. 2021; Vogt and Weckhuysen 2015). First reported by Argauer and Landolt at Mobil in 1972, it is a shape-selective acid catalyst used in FCC additives that raise the propylene yield, in methanol-to-hydrocarbons conversion and in xylene isomerisation (Vogt and Weckhuysen 2015; Matam et al. 2023; Feng P. et al. 2024). Its essentially all-silica form, silicalite (silicalite-1), has the same framework (Vogt and Weckhuysen 2015; Dalena et al. 2026). - [Zeolite A (LTA): structure, molecular sieves and uses](https://www.labcanvas.com/zeolites/zeolite-a): Zeolite A, framework type LTA (Linde Type A), is a synthetic aluminosilicate with Si/Al = 1, built from double four-ring units into small sodalite (β) cages and large α cages in a cubic arrangement (Chen et al. 2025; Ooe et al. 2023; Ren et al. 2011). The only way into the large cages is through eight-ring windows 4.1 × 4.1 Å across, and the cations that sit in them set what gets in: the sodium form is the 4A molecular sieve, the potassium-containing form 3A and the calcium-exchanged form 5A (Chen et al. 2025; Wu et al. 2019). It is used as a phosphate-free detergent builder, as a drying agent and for gas separation (Fruijtier-Pölloth 2009; Jović et al. 2017). - [Faujasite (zeolite X and Y): structure, USY and FCC](https://www.labcanvas.com/zeolites/faujasite): Faujasite, framework type FAU, is the zeolite framework of zeolites X and Y: sodalite cages joined to four neighbours through double six-rings, as carbon atoms are joined in diamond, enclosing supercages 12–13 Å across that connect through twelve-ring windows about 7.3 Å wide (Ooe et al. 2023; Vogt and Weckhuysen 2015; Pirngruber et al. 2010). X and Y have the same structure and differ only in Si/Al, about 1.25 for X and 2.5–2.8 for Y (Feldhoff et al. 2009; Liguori et al. 2019). Stabilised with rare earths or by steaming to ultrastable Y (USY), zeolite Y has been the main cracking component of fluid catalytic cracking (FCC) catalysts since 1964, and FCC makes most of the world’s gasoline (Vogt and Weckhuysen 2015). - [SSZ-13 (CHA): structure, Cu-SSZ-13 and uses](https://www.labcanvas.com/zeolites/ssz-13): SSZ-13 is a high-silica aluminosilicate zeolite with the chabazite (CHA) framework: double six-rings stacked in an ABC sequence enclose large CHA cages joined by 8-ring windows about 3.8 × 3.8 Å (Shan et al. 2021). Exchanged with copper, Cu-SSZ-13 is the commercial catalyst for the selective catalytic reduction of NOₓ with ammonia (NH₃-SCR) in diesel exhaust, prized for its wide temperature window and hydrothermal stability (Li P. et al. 2022; Beale et al. 2015). SSZ-13 is usually crystallised with N,N,N-trimethyl-1-adamantylammonium (TMAda⁺) as the organic template (Shan et al. 2021), and SAPO-34, the silicoaluminophosphate with the same CHA framework, is the commercial methanol-to-olefins catalyst (Yang et al. 2021). ## Graphical abstract and TOC graphic sizes (publishers' author guidelines, checked October 2026) - [Graphical abstract sizes for chemistry and materials journals](https://www.labcanvas.com/graphical-abstracts): one table of every publisher's size, with templates. - [ACS TOC graphic: sizes, rules and a template](https://www.labcanvas.com/graphical-abstracts/acs): ACS · TOC graphic, 3.25 × 1.75 in; ACS Nano · TOC, 9 × 4 cm; ACS Catalysis · ACS Sustain. Chem. Eng., 3.33 × 1.875 in; ACS Energy Letters · TOC, 3 × 2 in. - [Advanced Materials, AFM and Small: ToC image size and template](https://www.labcanvas.com/graphical-abstracts/wiley-advanced): Wiley · Adv. Mater., AFM, Small · ToC, 55 × 50 mm; Wiley · Adv. Mater., AFM, Small · ToC wide, 110 × 20 mm. - [Angewandte Chemie and Chemistry Europe: ToC graphic size and template](https://www.labcanvas.com/graphical-abstracts/angewandte): Angew. Chem. · Chem. Eur. J. · ToC, 5.5 × 5 cm; Angew. Chem. · Chem. Eur. J. · ToC wide, 11.5 × 2.5 cm. - [RSC graphical abstract: size, resolution and a template](https://www.labcanvas.com/graphical-abstracts/rsc): RSC · graphical abstract, 8 × 4 cm. - [Elsevier graphical abstract: size, ratio and a template](https://www.labcanvas.com/graphical-abstracts/elsevier): Elsevier · graphical abstract, 1328 × 531 px. - [Cell Press graphical abstract: size and template for Joule, Matter and Chem](https://www.labcanvas.com/graphical-abstracts/cell-press): Cell Press · graphical abstract, 1200 × 1200 px. - [MDPI graphical abstract: size and a template](https://www.labcanvas.com/graphical-abstracts/mdpi): MDPI · graphical abstract, 1100 × 560 px. - [Nano Research TOC graphic: size, resolution and a template](https://www.labcanvas.com/graphical-abstracts/nano-research): Nano Research · TOC, 80 × 50 mm. ## Characterisation techniques (how they work and how to read the data, cited) - [Materials characterisation techniques: what each one measures and when to use it](https://www.labcanvas.com/techniques): Materials characterisation is the set of measurements that tell a chemist what a new material is: its crystal structure (XRD, which identifies phases from Bragg diffraction; Abid et al. 2023), its surface chemistry (XPS, which reads the top 2–10 nm; Baio et al. 2020), its porosity (gas sorption and the BET surface area; Osterrieth et al. 2022), its size and shape (SEM, TEM, AFM and DLS), its bonding (NMR, FTIR and Raman), its stability (TGA and DSC), its optical band gap (UV–vis), its composition (ICP-MS) and its electrochemistry (cyclic voltammetry and EIS). No single technique is enough; each page below explains how one method works, what its data looks like, how to prepare samples and the mistakes to avoid, with every fact cited. - [X-ray diffraction (XRD): principle, how to read a pattern, and what it tells you](https://www.labcanvas.com/techniques/xrd): X-ray diffraction (XRD) measures how X-rays scattered by the ordered planes of atoms in a crystal interfere, giving sharp peaks at angles fixed by Bragg’s law, nλ = 2d sin θ, where d is the spacing of the lattice planes (Wang et al. 2026). Because the size and shape of the unit cell decide where those peaks fall, a diffraction pattern is a fingerprint that identifies crystalline phases and checks their purity (Abid et al. 2023). Peak widths give crystallite size and strain, and whole-pattern Rietveld refinement extracts lattice parameters and structural detail (Abid et al. 2023; Cline et al. 2015). - [X-ray photoelectron spectroscopy (XPS): principle, spectra and analysis](https://www.labcanvas.com/techniques/xps): X-ray photoelectron spectroscopy (XPS, also called ESCA) shines X-rays on a sample and measures the kinetic energy of the core electrons they eject; from the photon energy and that kinetic energy the electron’s binding energy follows (Baio et al. 2020). Binding energies identify every element except hydrogen and helium, and small shifts in them reveal oxidation states and bonding (Baio et al. 2020). Because the photoelectrons escape only from the outermost few nanometres, about 2–10 nm, XPS is a surface technique that gives quantitative surface composition and chemistry (Baio et al. 2020). - [BET surface area and gas sorption: isotherms, pore size and how to report them](https://www.labcanvas.com/techniques/bet): Gas sorption measures how much gas, usually nitrogen at 77 K, a degassed solid takes up as the pressure rises, giving an isotherm from which surface area, pore size and pore volume are calculated (Abid et al. 2023). The Brunauer–Emmett–Teller (BET) method, developed in the 1930s for open surfaces, turns the low-pressure part of that isotherm into a monolayer amount and a "BET area", and is now the most widely used surface-area metric for micro- and mesoporous materials (Osterrieth et al. 2022). For microporous solids such as MOFs, where pores fill rather than form layers, the result depends strongly on the pressure range chosen, so it should be calculated with consistency criteria (Gómez-Gualdrón et al. 2016; Osterrieth et al. 2022). - [Scanning electron microscopy (SEM): how it works, SE vs BSE images and EDS](https://www.labcanvas.com/techniques/sem): Scanning electron microscopy (SEM) images the surface of a solid by scanning a focused electron beam across it and collecting the signals the beam generates: secondary electrons show topography, backscattered electrons show contrast between elements of different atomic number, and X-rays identify the elements present (Erlich et al. 2020). It is the standard tool for particle size, shape and morphology, with nanometre-scale resolution (Joo et al. 2025; Bijelić et al. 2023). With an energy-dispersive X-ray (EDS) detector it also maps composition, detecting every element except H and He (Newbury & Ritchie 2015). - [Transmission electron microscopy (TEM): how it works, HRTEM, SAED and STEM-HAADF](https://www.labcanvas.com/techniques/tem): Transmission electron microscopy (TEM) sends a beam of high-energy electrons through a sample thinner than about 100 nm and forms images and diffraction patterns from the electrons that pass through (Bijelić et al. 2023). High-resolution TEM resolves crystal lattices and defects at atomic scale, electron diffraction gives crystal structure, and in scanning mode (STEM) the high-angle annular dark-field signal scales roughly with the square of atomic number, so heavy atoms appear bright (Bijelić et al. 2023; Zheng et al. 2023). Beam-sensitive materials such as MOFs need low-dose or cryogenic conditions (Zheng et al. 2023). - [Atomic force microscopy (AFM): how it works, contact vs tapping mode and height profiles](https://www.labcanvas.com/techniques/afm): Atomic force microscopy (AFM) maps a surface by scanning a nanometre-sharp tip on a flexible cantilever across it; a laser reflected off the cantilever onto a photodiode records its bending, and a feedback loop moves the scanner up and down to keep the tip–sample interaction constant, so the scanner height becomes a 3D topographic map (Joo et al. 2025). It reaches 1–10 nm lateral and sub-nanometre vertical resolution without vacuum, which makes it the standard way to measure the thickness of 2D flakes, roughness and step heights, and its special modes map mechanical, electrical and magnetic properties (Joo et al. 2025). - [NMR spectroscopy: how it works, how to read a spectrum and what it tells you about materials](https://www.labcanvas.com/techniques/nmr): Nuclear magnetic resonance (NMR) spectroscopy measures the radio-frequency response of atomic nuclei with spin, such as ¹H and ¹³C, held in a strong magnetic field. The electrons around each nucleus shield it from the field, so chemically different atoms resonate at slightly different positions, the chemical shift, quoted in ppm (Armitage et al. 2013). A spectrum identifies which atoms are present and how they are bonded, peak areas count them quantitatively (Pauli et al. 2014), and solid-state magic-angle-spinning NMR gives the local structure of solids such as MOFs and zeolites that diffraction cannot see (Brunner & Rauche 2020). - [FTIR spectroscopy: how it works, how to read an infrared spectrum and what it tells you about materials](https://www.labcanvas.com/techniques/ftir): Fourier-transform infrared (FTIR) spectroscopy measures how much infrared light a sample absorbs at each wavenumber. Bonds whose dipole moment changes as they vibrate absorb at characteristic wavenumbers (Baker et al. 2014), and an FTIR instrument records all of them at once with a Michelson interferometer, the spectrum being the Fourier transform of the interferogram (Lagos et al. 2018). The result is a fingerprint of the bonds present: S–H, C–H, N–H and O–H stretches between about 2,550 and 3,500 cm⁻¹, and bending and skeletal vibrations in the fingerprint region from about 600 to 1,450 cm⁻¹ (Baker et al. 2014). - [Raman spectroscopy: how it works, how to read a Raman spectrum and what it tells you about materials](https://www.labcanvas.com/techniques/raman): Raman spectroscopy shines a monochromatic laser on a sample and measures the small fraction of light that is scattered inelastically, with its energy shifted up or down by molecular vibrations or lattice phonons (Jones et al. 2019; Silver et al. 2019). The spectrum is plotted as the Raman shift in cm⁻¹, the difference between the laser and scattered wavenumbers, and each band corresponds to a vibration (Jones et al. 2019). It identifies compounds and phases non-destructively, works in water (Butler et al. 2016), and for graphene its D, G and 2D bands give the number of layers and the defect density (Ferrari et al. 2006; Cançado et al. 2011). - [TGA and DSC: how thermogravimetric analysis and differential scanning calorimetry work and how to read the curves](https://www.labcanvas.com/techniques/tga-dsc): Thermogravimetric analysis (TGA) records the mass of a sample, and the rate at which it changes, as the sample is heated in a controlled atmosphere; steps in the curve show loss of water and solvent, decomposition and the residue left behind (Abid et al. 2023; Nurazzi et al. 2021). Differential scanning calorimetry (DSC) records the difference in heat flow needed to keep a sample and a reference at the same temperature, so it shows the glass transition as a step and crystallisation and melting as peaks (Leyva-Porras et al. 2019). Together they tell a chemist how stable a material is, what it contains and which phase transitions it goes through. - [UV–vis spectroscopy: how it works, the Beer–Lambert law, band gaps from Tauc plots and plasmon bands](https://www.labcanvas.com/techniques/uv-vis): UV–vis spectroscopy measures how much ultraviolet and visible light a sample absorbs at each wavelength, usually reported as absorbance, the negative decadic logarithm of the transmittance (Mayerhöfer et al. 2019). By the Beer–Lambert law absorbance is proportional to concentration and path length, A = εcl, which makes UV–vis the everyday way to measure concentration (Mayerhöfer et al. 2019). For semiconductors the absorption edge gives the optical band gap through a Tauc plot, with diffuse reflectance used for powders (Escobedo-Morales et al. 2019), and for gold nanoparticles the plasmon band reports size, concentration and aggregation (Haiss et al. 2007; Wang et al. 2026). - [Dynamic light scattering (DLS) and zeta potential: how they work and how to read size, PDI and ζ](https://www.labcanvas.com/techniques/dls-zeta): Dynamic light scattering (DLS) shines a laser into a dilute dispersion and records how fast the scattered intensity fluctuates as particles move by Brownian motion; small particles move quickly and large ones slowly (Rodriguez-Loya et al. 2023). The decay of the intensity autocorrelation gives a diffusion coefficient, which the Stokes–Einstein equation turns into a hydrodynamic diameter (Wishard & Gibb 2019), and a cumulants fit gives the polydispersity index, PDI (Danaei et al. 2018). Zeta potential is measured in the same instruments by electrophoretic light scattering: the particle velocity in an electric field gives the electrophoretic mobility and, through Henry's equation, the potential at the slipping plane, with values beyond about ±30 mV usually read as a stable dispersion (Rodriguez-Loya et al. 2023). - [Cyclic voltammetry (CV): how it works and how to read a voltammogram](https://www.labcanvas.com/techniques/cyclic-voltammetry): Cyclic voltammetry (CV) sweeps the potential of a working electrode linearly against a reference electrode, forward and then back, while recording the current; the resulting current–potential trace is the cyclic voltammogram (Rafiee et al. 2024). Oxidation and reduction peaks appear where a redox couple reacts, the midpoint of the two peaks gives its formal potential, and for a reversible, diffusion-controlled couple the peaks sit about 59/n mV apart (Rafiee et al. 2024; Venton & Cao 2020). For materials scientists CV reports redox potentials, reversibility, whether a species diffuses or is adsorbed, coupled chemical steps, catalytic currents and the electrochemically active surface area of electrocatalysts (Rafiee et al. 2024; Sharma et al. 2026). - [Electrochemical impedance spectroscopy (EIS): principle, Nyquist plots and equivalent circuits](https://www.labcanvas.com/techniques/eis): Electrochemical impedance spectroscopy (EIS) applies a small sinusoidal voltage (or current), usually on top of a DC potential, to an electrochemical cell over a wide range of frequencies and measures the impedance from the amplitude and phase of the response (Lazanas & Prodromidis 2023). Because double-layer charging, electron transfer and diffusion have different time constants, they appear at different frequencies and can be separated, typically by fitting an equivalent circuit such as the Randles circuit (Lazanas & Prodromidis 2023; Sharma et al. 2026). EIS gives a materials scientist the electrolyte resistance, charge-transfer resistance, double-layer capacitance and diffusion behaviour of batteries, electrocatalysts, solid electrolytes and sensors (Lazanas & Prodromidis 2023). - [ICP-MS and ICP-OES: elemental analysis with an inductively coupled plasma](https://www.labcanvas.com/techniques/icp-ms): Inductively coupled plasma mass spectrometry (ICP-MS) measures which elements a sample contains and how much: a dissolved sample is nebulised into an argon plasma that vaporises, atomises and ionises it into singly charged positive ions, which a mass spectrometer sorts by mass-to-charge ratio (Mazarakioti et al. 2022). It covers more than 65 elements with detection limits in the ng L⁻¹ range for most of them and also gives isotope ratios (Mazarakioti et al. 2022). ICP-OES uses the same kind of plasma but reads the light emitted at element-specific spectral lines and is normally less sensitive (Provete et al. 2024); chemists use both to measure metal loadings, stoichiometry, impurities and leached metal in catalysts, MOFs and battery materials (Bekmyrza et al. 2025; Recknagel et al. 2025). ## Free science diagrams (CC BY 4.0) - [Plant cell diagram with labels](https://www.labcanvas.com/diagrams/plant-cell-diagram): A plant cell is a eukaryotic cell with three structures animal cells lack: a rigid cellulose cell wall, chloroplasts for photosynthesis and a large central vacuole. It also has the organelles all eukaryotic cells share, including a nucleus, endoplasmic reticulum, Golgi apparatus, mitochondria, ribosomes and peroxisomes. This free diagram labels 16 parts and comes unlabelled and as a numbered worksheet with an answer key. - [Animal cell diagram with labels](https://www.labcanvas.com/diagrams/animal-cell-diagram): An animal cell is a eukaryotic cell with a flexible plasma membrane and no cell wall, chloroplasts or large central vacuole. Inside are a nucleus, rough and smooth endoplasmic reticulum, a Golgi apparatus, mitochondria, ribosomes, peroxisomes and a cytoskeleton, plus two structures typical plant cells lack: lysosomes and a centrosome with a pair of centrioles. This free diagram labels 15 parts and comes unlabelled and as a numbered worksheet with an answer key. - [Cell membrane diagram (fluid mosaic model)](https://www.labcanvas.com/diagrams/cell-membrane-diagram): A cell membrane diagram shows the plasma membrane as a phospholipid bilayer: two layers of phospholipids with their hydrophilic heads facing the watery fluid on each side and their hydrophobic tails facing inward. Proteins sit in and on the bilayer, cholesterol is tucked between the phospholipids, and carbohydrate chains attached to proteins (glycoproteins) and lipids (glycolipids) face the extracellular fluid. Because the parts can move sideways and the proteins are scattered like tiles, this picture is called the fluid mosaic model. - [Mitochondria diagram (labeled structure)](https://www.labcanvas.com/diagrams/mitochondria-diagram): A mitochondria diagram shows a mitochondrion cut lengthways: a smooth outer membrane, a narrow intermembrane space, and an inner membrane folded into cristae that surround the fluid matrix. ATP synthase particles stud the cristae, and the matrix holds the mitochondrion’s own circular DNA and ribosomes. Mitochondria make most of a eukaryotic cell’s ATP by cellular respiration, which is why they are often called the powerhouse of the cell. - [Mitosis diagram with labels](https://www.labcanvas.com/diagrams/mitosis-diagram): Mitosis is the division of a nucleus into two genetically identical nuclei. In this labeled diagram an animal cell with four chromosomes (two homologous pairs) passes through interphase, prophase, prometaphase, metaphase, anaphase and telophase, and cytokinesis then splits the cytoplasm to give two daughter cells. Each daughter cell keeps the same four chromosomes as the parent cell, because the sister chromatids of every chromosome are pulled to opposite poles in anaphase. - [Meiosis diagram with labels](https://www.labcanvas.com/diagrams/meiosis-diagram): Meiosis is the cell division that turns one diploid cell into four haploid cells, each with half the chromosomes. In this labeled diagram a cell with two homologous pairs (2n = 4) copies its DNA once and then divides twice: meiosis I separates the homologous chromosomes, and meiosis II separates the sister chromatids. Crossing over in prophase I and the random line-up of pairs in metaphase I make all four haploid cells (n = 2) genetically different. - [Cell cycle diagram (labelled)](https://www.labcanvas.com/diagrams/cell-cycle-diagram): The cell cycle is the ordered series of events in which a cell grows, copies its DNA and divides into two daughter cells. It has two main parts: interphase, made of G1 (growth), S (DNA replication) and G2 (preparation for division), and the M phase, made of mitosis (division of the nucleus) and cytokinesis (division of the cytoplasm). Cells that stop dividing leave G1 for a resting state called G0, and checkpoints at G1/S, G2/M and in metaphase (the spindle checkpoint) only let the cycle continue when the cell is ready. - [Ear diagram (labelled parts of the human ear)](https://www.labcanvas.com/diagrams/ear-diagram): The human ear has three parts. The outer ear (pinna and external auditory canal) collects sound and channels it to the tympanic membrane (eardrum). The middle ear is an air-filled cavity where three tiny bones, the malleus, incus and stapes, carry the eardrum’s vibrations to the oval window, and the Eustachian tube links it to the throat. The fluid-filled inner ear holds the cochlea, which turns vibrations into nerve signals for hearing, and the vestibule and semicircular canals, which sense balance; the vestibulocochlear nerve carries both to the brain. - [Digestive system diagram with labels](https://www.labcanvas.com/diagrams/digestive-system-diagram): The digestive system is the alimentary canal, one continuous tube from the mouth through the pharynx, oesophagus, stomach, small intestine and large intestine to the anus, plus accessory organs that help digestion: the teeth, tongue, salivary glands, liver, gallbladder and pancreas. Food is broken down mechanically and chemically, nutrients are absorbed mainly in the small intestine, and waste leaves as feces. This free diagram labels 16 parts and comes unlabelled and as a numbered worksheet. - [Heart diagram with labels](https://www.labcanvas.com/diagrams/heart-diagram): The human heart has four chambers: two upper atria that receive blood and two lower ventricles that pump it out. The right side sends deoxygenated blood to the lungs through the pulmonary artery, and the left side sends oxygenated blood to the body through the aorta. Four valves (tricuspid, pulmonary, mitral and aortic) keep blood flowing one way. This free diagram labels 16 parts and comes unlabelled and as a numbered worksheet. - [Eye diagram with labels](https://www.labcanvas.com/diagrams/eye-diagram): The human eye is a fluid-filled ball with a wall of three layers: the tough white sclera (with the clear cornea at the front), the blood-rich choroid, and the light-sensitive retina. Light passes through the cornea, the aqueous humour, the pupil in the iris, the lens and the vitreous humour, and is focused on the retina, where photoreceptors turn it into nerve signals that leave through the optic nerve. This free diagram labels 15 parts and comes unlabelled and as a numbered worksheet with an answer key. - [Neuron diagram with labels](https://www.labcanvas.com/diagrams/neuron-diagram): A neuron is a nerve cell that carries electrical and chemical signals. Its dendrites receive signals and pass them to the cell body (soma), which holds the nucleus; the signal then travels from the axon hillock along a single axon, insulated by a myelin sheath with gaps called nodes of Ranvier, to the axon terminals, which pass it on to the next cell. This free diagram of a multipolar motor neuron labels 9 parts and comes unlabelled and as a numbered worksheet with an answer key. - [Parts of a microscope diagram (labeled)](https://www.labcanvas.com/diagrams/microscope-diagram): A compound light microscope magnifies a specimen in two stages: an objective lens near the slide makes an enlarged image, and the eyepiece (ocular lens) magnifies that image again, so total magnification is the eyepiece power times the objective power. Light from the illuminator passes up through the condenser and iris diaphragm, through the specimen on the stage, and into the objective. This free diagram labels 13 parts and comes unlabelled and as a numbered worksheet with an answer key. - [The water cycle labeled diagram](https://www.labcanvas.com/diagrams/water-cycle-diagram): The water cycle (hydrologic cycle) is the continuous movement of water between the oceans, the air and the land, powered by energy from the sun. Water evaporates from the ocean, transpires from plants and sublimates from snow and ice; the vapour condenses into clouds and falls as precipitation, then runs off the surface or infiltrates the ground and flows back to the ocean, where it collects. This free diagram labels 9 processes and comes unlabelled and as a numbered worksheet with an answer key. - [Photosynthesis diagram with labels](https://www.labcanvas.com/diagrams/photosynthesis-diagram): Photosynthesis happens in the chloroplast in two linked stages. The light-dependent reactions take place on the thylakoid membranes: they absorb light, split water and release oxygen, and make ATP and NADPH. The Calvin cycle takes place in the stroma: it uses that ATP and NADPH to turn carbon dioxide into sugar, sending ADP and NADP+ back to be recharged. Overall, 6CO2 + 6H2O gives C6H12O6 + 6O2. - [DNA structure diagram with labels](https://www.labcanvas.com/diagrams/dna-structure-diagram): DNA is a double helix: two strands of nucleotides wound around each other. Each strand has a backbone of alternating deoxyribose sugars and phosphates, and the nitrogenous bases point inwards, where they pair by hydrogen bonds, adenine with thymine (2 bonds) and guanine with cytosine (3 bonds). The two strands run in opposite directions (antiparallel), 5' to 3' and 3' to 5', and the twist leaves a major and a minor groove. - [Bacterial cell diagram with labels](https://www.labcanvas.com/diagrams/bacterial-cell-diagram): A bacterial cell is a prokaryotic cell: it has no nucleus and no membrane-bound organelles. Its DNA sits in a region of the cytoplasm called the nucleoid, often with extra small DNA circles called plasmids, and its proteins are made on 70S ribosomes. Most bacteria are wrapped in a peptidoglycan cell wall, many add a capsule, and many have flagella, pili and fimbriae. This free diagram labels 11 parts of a rod-shaped bacterium and comes unlabelled and as a numbered worksheet. - [Virus diagram with labels](https://www.labcanvas.com/diagrams/virus-diagram): A virus is not a cell: each virus particle (virion) is a genome of DNA or RNA packed inside a protein coat called a capsid, which is built from subunits called capsomeres. Some viruses, such as influenza, are also wrapped in a lipid envelope taken from the host cell and studded with glycoprotein spikes. Bacteriophages, viruses that infect bacteria, often have a head, a tail sheath, a base plate and tail fibres. This free diagram labels both types and comes unlabelled and as a worksheet. ## Free tools (no account needed) - [LaTeX equation to PNG and SVG](https://www.labcanvas.com/tools/latex) (updated 2026-11-08): Type a LaTeX equation, pick a colour and size, and download it as a transparent PNG (with its DPI recorded) or as a vector SVG. The equation is typeset by MathJax in your browser, supports AMS environments and chemical equations with \ce{…}, and works in PowerPoint, Google Slides, Word, Keynote and figure editors. Formula: MathJax 3 TeX input (AMS math, mhchem \ce{…}) rendered to SVG paths; PNG pixels = size at 96 dpi × DPI ÷ 96. Example: An equation 400 px wide at 96 dpi is 400 ÷ 96 = 4.17 inches wide; exported at 300 dpi the PNG is 400 × 300 ÷ 96 = 1250 px wide and still prints 4.17 inches wide. - [Colorblind-safe scientific color palettes](https://www.labcanvas.com/tools/palettes) (updated 2026-11-08): Pick a published colour palette for your scientific figures (Okabe–Ito, Paul Tol, viridis, cividis, ColorBrewer and journal-style sets), see it on a chart as people with protanopia, deuteranopia or tritanopia would, and copy the colours as HEX codes or ready-to-paste Python (matplotlib), R (ggplot2), CSS or JSON. Formula: Colour-vision deficiency simulated with the Machado, Oliveira & Fernandes 2009 matrices in linear RGB; smallest ΔE*ab (CIELAB) ≥ 10 under protanopia and deuteranopia = colour-blind friendly. Example: Okabe–Ito’s 8 colours keep a smallest difference of ΔE*ab ≈ 17 under simulated protanopia and deuteranopia, above the threshold of 10, so the palette is labelled colour-blind friendly. - [Colour-blindness checker for scientific figures](https://www.labcanvas.com/tools/scientific-figure-color-blindness-checker) (updated 2026-11-08): Upload a figure, chart or micrograph to see how it looks with protanopia, deuteranopia, tritanopia and monochrome vision, side by side. The checker also finds the main colours in the image and lists pairs that become hard to tell apart, so you know what to fix before submission. The image never leaves your browser. Formula: Machado, Oliveira & Fernandes 2009 dichromacy matrices in linear RGB, Rec. 709 luminance for monochrome; a pair is flagged when ΔE > 20 normally but ΔE < 12 after simulation. Example: Red #D62728 and green #2CA02C differ by ΔE ≈ 120 for normal vision but only ΔE ≈ 7 with deuteranopia, so the checker flags them as a confusable pair. - [Multi-panel figure maker for journals](https://www.labcanvas.com/tools/figure-panel-maker) (updated 2026-11-08): Add your images, choose a layout (2 × 2, 1 × 3, five panels as 2 + 3, a large panel with two small ones and more), set the journal column width and the panel letters, and export the multi-panel figure as a PNG at 300, 600 or 1200 dpi that records its resolution. Everything happens in your browser. Formula: Panel width = (figure width − gaps) ÷ columns; panel height = panel width ÷ aspect ratio; pixels = mm ÷ 25.4 × DPI. Example: A 183 mm Nature figure with a 2 × 2 layout, 4:3 panels and 2 mm gaps has 90.5 × 67.9 mm panels, a 183 × 138 mm figure and 2161 × 1627 px at 300 dpi. - [Scientific figure legend generator](https://www.labcanvas.com/tools/scientific-figure-legend-generator) (updated 2026-11-08): Fill in a short form (the main finding, what each panel shows, how data are summarised, the sample size, the statistical test, significance levels and scale bars) and get a complete figure legend formatted in Nature, Cell Press or a generic style, ready to copy into your manuscript. Formula: Fixed journal order: finding as title, one sentence per panel, data summary and n, test and correction, significance thresholds, scale bars, abbreviations; nothing is invented. Example: Nature style: “Fig. 1 | Drug X reduces tumour growth… Data are presented as mean ± s.e.m.; n = 8 mice per group… *P < 0.05, **P < 0.01, ***P < 0.001… Scale bars, 50 µm.” - [Molarity calculator](https://www.labcanvas.com/tools/molarity-calculator) (updated 2026-11-08): To make a solution of a given molarity, weigh mass (g) = concentration (mol/L) × volume (L) × molar mass (g/mol). Enter any two of mass, concentration and volume plus the molar mass, and the calculator gives the third, with units from kilograms to nanograms and molar to picomolar. Formula: m = C × V × M (g = mol/L × L × g/mol); C = m ÷ (V × M); V = m ÷ (C × M). Example: For 500 mL of 150 mM NaCl (M = 58.44 g/mol): m = 0.150 mol/L × 0.500 L × 58.44 g/mol = 4.383 g, made up to 500 mL. - [C1V1 = C2V2 dilution calculator](https://www.labcanvas.com/tools/dilution-calculator) (updated 2026-11-08): C1V1 = C2V2 is the dilution formula: stock concentration × stock volume = final concentration × final volume. To find how much stock to use, V1 = C2 × V2 / C1, then add diluent up to V2. Example: for 1 mL of 1 mM from a 10 mM stock, V1 = 1 mM × 1 mL / 10 mM = 0.1 mL, so 100 µL of stock plus 900 µL of diluent. Enter any three values to get the fourth, with molar, mass, percent or ×-fold units, or plan a serial dilution tube by tube. Formula: C₁ × V₁ = C₂ × V₂, so V₁ = C₂ × V₂ ÷ C₁; serial dilution tube k = C₀ ÷ fᵏ. Example: To make 1 mL of 1 mM from a 10 mM stock: V₁ = 1 mM × 1 mL ÷ 10 mM = 0.1 mL, so 100 µL of stock plus 900 µL of diluent. - [pH calculator](https://www.labcanvas.com/tools/ph-calculator) (updated 2026-11-08): pH = −log₁₀[H⁺] and, at 25 °C, pH + pOH = 14. This calculator converts between pH, pOH, [H⁺] and [OH⁻], gives the pH of strong and weak acids and bases (solving the full equilibrium, including water), and calculates buffer pH or the base-to-acid ratio for a target pH with the Henderson–Hasselbalch equation. Formula: pH = −log₁₀[H⁺]; Kw = 1.0 × 10⁻¹⁴; weak acid: [H⁺]³ + Ka[H⁺]² − (KaC + Kw)[H⁺] − KaKw = 0; buffer pH = pKa + log₁₀([A⁻]/[HA]). Example: 0.1 M acetic acid (pKa 4.76) gives [H⁺] = 1.31 × 10⁻³ M, so pH = 2.88 with 1.3 % ionised. - [qPCR delta delta Ct (ΔΔCt) calculator](https://www.labcanvas.com/tools/qpcr-calculator) (updated 2026-11-08): Relative gene expression by the delta delta Ct method (Livak, also called the comparative Ct method) is fold change = 2^−ΔΔCt, where ΔCt = Ct(target) − Ct(reference gene) and ΔΔCt = ΔCt(sample) − ΔCt(control). Paste your Ct values (one row per well, replicates included), choose the control sample, and the calculator gives ΔCt, ΔΔCt, fold change with its SD range, the Pfaffl ratio if efficiencies differ from 100 %, a chart and a CSV. Formula: ΔCt = Ct(target) − Ct(reference); ΔΔCt = mean ΔCt(sample) − mean ΔCt(control); fold change = 2^−ΔΔCt. Example: Mean ΔCt 6.80 in treated and 9.93 in control cells gives ΔΔCt = −3.13, so fold change = 2^3.13 = 8.77 (8.8-fold higher expression). - [Cell doubling time calculator](https://www.labcanvas.com/tools/cell-doubling-time-calculator) (updated 2026-11-08): Doubling time Td = t × ln 2 / ln(N / N₀), where N₀ and N are the cell counts at the start and end of an interval t in exponential growth. Enter two counts and the time, or paste a growth curve to fit ln(N) against time, and get the doubling time, growth rate and doublings per day. Formula: Td = t × ln 2 ÷ ln(N ÷ N₀); µ = ln(N ÷ N₀) ÷ t = ln 2 ÷ Td. Example: 100,000 cells growing to 400,000 in 48 h: Td = 48 × 0.693 ÷ ln 4 = 24 h (two doublings), µ = 0.0289 per hour. - [Western blot and SDS-PAGE molecular weight calculator](https://www.labcanvas.com/tools/western-blot-mw-calculator) (updated 2026-11-08): Upload a photo of your gel or blot, click the ladder bands (their sizes fill in from the ladder you choose), then click your sample bands. The calculator fits log₁₀(molecular weight) against migration distance and reports each band’s estimated size in kDa, with R², an annotated image and a CSV. It also works with distances typed in by hand. Formula: log₁₀(MW) = a + b × migration distance, fitted by least squares to the ladder bands. Example: With the 70 kDa band at 210 px and the 55 kDa band at 262 px, a sample band at 236 px is about 62 kDa. - [ELISA standard curve calculator with 4PL curve fitting](https://www.labcanvas.com/tools/elisa-standard-curve-analyzer) (updated 2026-11-08): Enter your standards (concentration and OD, with replicates) and your samples’ ODs and dilution factors. The calculator fits a four-parameter logistic (4PL) standard curve, or a linear or log-log line, subtracts the blank, and calculates each sample’s concentration, flagging values outside the standard range. It works for sandwich and competitive ELISAs. You get R², the fitted parameters, a chart and a CSV. Formula: 4PL: y = Bottom + (Top − Bottom) ÷ (1 + (EC50 ÷ x)^Hill); inverse x = EC50 × ((Top − Bottom) ÷ (y − Bottom) − 1)^(−1/Hill). Example: With Bottom 0.024, Top 2.865, EC50 280 pg/mL and Hill 1.19, a blank-corrected OD of 0.885 reads 139 pg/mL; diluted 1:2, the sample holds 277 pg/mL. - [IC50 and EC50 calculator with a four-parameter logistic fit](https://www.labcanvas.com/tools/ic50-calculator) (updated 2026-11-08): Paste concentrations and responses (with replicates) and the calculator fits a four-parameter logistic (Hill) curve on a log-concentration axis. It gives the relative IC50 or EC50 with its 95% confidence interval, the Hill slope, the top and bottom plateaus and R², plus the absolute IC50 when you normalise to 0% and 100% controls, with a chart and a CSV. Formula: Y = Bottom + (Top − Bottom) ÷ (1 + 10^((logIC50 − log X) × HillSlope)); 95% CI = logIC50 ± t × SE, back-transformed. Example: The built-in 9-concentration triplicate inhibition curve fits to a relative IC50 of 35.29 nM (95% CI 29.59–42.08 nM), Hill slope −1.19, R² = 0.9901. - [Centrifuge RPM to g-force (RCF) calculator](https://www.labcanvas.com/tools/centrifuge-rpm-rcf-calculator) (updated 2026-11-08): RCF (× g) = 1.118 × 10⁻⁵ × r × RPM², with r the rotor radius in centimetres; to go the other way, RPM = √(RCF / (1.118 × 10⁻⁵ × r)). For example, 10,000 RPM at a radius of 10 cm is 11,180 × g. Enter the speed or the g-force and the radius, or convert a protocol’s speed to the speed that gives the same g-force on your own rotor. Formula: RCF = 1.118 × 10⁻⁵ × r (cm) × RPM²; RPM = √(RCF ÷ (1.118 × 10⁻⁵ × r)); RPM₂ = RPM₁ × √(r₁ ÷ r₂). Example: 10,000 RPM at a 10 cm radius: RCF = 1.118 × 10⁻⁵ × 10 × 10,000² = 11,180 × g. - [Molar mass calculator](https://www.labcanvas.com/tools/molar-mass-calculator) (updated 2026-11-08): The molar mass of a compound is the sum of the standard atomic weights of its atoms, in g/mol: for water, H₂O = 2 × 1.0080 + 15.999 = 18.015 g/mol. Type a formula, including brackets, hydrates (CuSO4·5H2O or CuSO4*5H2O) and decimal counts, and get the molar mass with each element’s count, atomic weight and mass percentage, using the IUPAC (CIAAW) 2021 standard atomic weights. Formula: M = Σ nᵢ × Aᵣ(i); mass %ᵢ = 100 × nᵢ × Aᵣ(i) ÷ M. Example: CuSO₄·5H₂O: 63.546 + 32.06 + 9 × 15.999 + 10 × 1.0080 = 249.677 g/mol, of which copper is 25.45 %. - [XRD crystallite size (Scherrer) and d-spacing (Bragg) calculator](https://www.labcanvas.com/tools/xrd-scherrer-calculator) (updated 2026-11-08): Crystallite size D = Kλ / (β cos θ), where β is the peak’s full width at half maximum in radians, θ is half the 2θ peak position, λ the X-ray wavelength and K ≈ 0.9; the d-spacing comes from Bragg’s law, d = nλ / 2 sin θ. Paste your peak positions and widths to get the size and d-spacing of every peak and their mean, with the instrument’s broadening removed if you enter it. Formula: D = Kλ ÷ (β cos θ), β = FWHM in radians, K ≈ 0.9; nλ = 2d sin θ; β = √(β_obs² − β_inst²). Example: A peak at 2θ = 36.3° with FWHM 0.40° (Cu Kα1, 1.54056 Å, K = 0.9): D = 0.9 × 0.154056 nm ÷ (0.006981 × 0.9502) = 20.9 nm, d = 2.473 Å. - [Supercapacitor specific capacitance, energy density and battery C-rate calculator](https://www.labcanvas.com/tools/supercapacitor-calculator) (updated 2026-11-08): Specific capacitance from a galvanostatic discharge is C = I·Δt / (m·ΔV), with I the current, Δt the discharge time, m the active mass and ΔV the voltage window without the IR drop; from a cyclic voltammogram it is C = ∮I dV / (2·m·v·ΔV) at scan rate v. For a two-electrode cell the energy density is E = ½·C·ΔV² and the power density P = E / Δt; for a battery, the current at n C is n × the capacity and a full charge or discharge takes 1/n hours. Formula: GCD: C = I·Δt ÷ (m·ΔV); CV: C = ∮I dV ÷ (2·m·v·ΔV); E = ½·C·ΔV²; P = E ÷ Δt; battery current = C-rate × capacity. Example: A symmetric cell (2 mg total) discharged at 1 mA for 100 s over 0.95 V after the IR drop: C = 0.001 × 100 ÷ (0.002 × 0.95) = 52.6 F/g, E = 6.60 Wh/kg. - [Protein molecular weight, pI and extinction coefficient calculator](https://www.labcanvas.com/tools/protein-parameter-calculator) (updated 2026-11-08): Paste a protein sequence in one-letter code or FASTA and the calculator adds up the residue masses to give the molecular weight (average and monoisotopic), predicts the molar extinction coefficient at 280 nm from its Trp, Tyr and cystine content (ε280 = 5500 × Trp + 1490 × Tyr + 125 × cystine, Pace et al. 1995), and finds the theoretical isoelectric point and net charge from published pK values. Enter an A280 reading to get the protein concentration in mg/mL and µM. Formula: M = Σ residue masses + H₂O; ε280 = 5500 × Trp + 1490 × Tyr + 125 × cystine (Pace et al. 1995); c = A280 ÷ (ε × l). Example: Angiotensin II (DRVYIHPF): 1046.20 Da, one Tyr so ε280 = 1490 M⁻¹ cm⁻¹; an A280 of 0.85 at 1 cm gives 570.5 µM = 0.597 mg/mL. - [Ligation calculator: insert mass for any insert:vector molar ratio](https://www.labcanvas.com/tools/ligation-calculator) (updated 2026-11-08): For a ligation, ng of insert = molar ratio × ng of vector × (insert length in bp / vector length in bp). With 50 ng of a 5,400 bp vector and a 1,200 bp insert, a 3:1 insert:vector ratio needs 33.3 ng of insert; the calculator also gives the pmol of each piece and the amounts for multi-fragment assemblies. Formula: ng insert = ratio × ng vector × insert bp ÷ vector bp; pmol = ng × 1000 ÷ (bp × 650). Example: 50 ng of a 5,400 bp vector with a 1,200 bp insert at 3:1: 3 × 50 ng × 1,200 ÷ 5,400 = 33.3 ng of insert (vector 0.0142 pmol). - [Hemocytometer cell count and cell seeding calculator](https://www.labcanvas.com/tools/cell-count-calculator) (updated 2026-11-08): Cells per mL = the mean count per large corner square × 10,000 × the dilution factor; with equal volumes of cells and trypan blue the dilution is 2. Viability is live cells ÷ (live + dead) × 100. The calculator then gives the volume of suspension and medium to seed a set number of cells in each well. Formula: cells/mL = mean count per large square × 10,000 × dilution; viability = live ÷ (live + dead) × 100. Example: A mean of 49 clear cells per large square, mixed 1:1 with trypan blue: 49 × 10,000 × 2 = 980,000 cells/mL; with 3 blue cells, viability = 49 ÷ 52 = 94.2 %. - [Primer Tm calculator (nearest-neighbour, with salt and Mg²⁺)](https://www.labcanvas.com/tools/primer-tm-calculator) (updated 2026-11-08): Paste one or two primers (5′→3′) and the calculator gives each primer’s melting temperature from the SantaLucia 1998 nearest-neighbour parameters, corrected for your oligo concentration, Na⁺/K⁺, Mg²⁺ and dNTPs, with the Tm difference between the primers, GC content, molar mass, ΔH°, ΔS°, the G/C count at the 3′ end and the longest repeats. Formula: Tm = ΔH° ÷ (ΔS° + R ln(C_T/F)) − 273.15; ΔS° += 0.368 × (N − 1) × ln[Na⁺]eq, [Na⁺]eq = [Na⁺] + [K⁺] + [Tris]/2 + 3.79√([Mg²⁺] − [dNTP]). Example: AGCGGATAACAATTTCACACAGGA at 250 nM in 50 mM K⁺, 1.5 mM Mg²⁺, 0.8 mM dNTP: Tm = 184,400 ÷ (516.74 + 30.21) − 273.15 = 64.0 °C. - [DNA and RNA concentration, copy number and qPCR standards](https://www.labcanvas.com/tools/dna-concentration-calculator) (updated 2026-11-08): Enter an A260 and the calculator gives the concentration (dsDNA 50, RNA 40 or ssDNA 38 ng/µL per absorbance unit at 1 cm) with the A260/A280 and A260/A230 ratios; then converts ng/µL to nM and copies per µL from the length or sequence of your plasmid, PCR product, oligo or RNA, and lays out a serial dilution series for a qPCR standard curve. Formula: c (ng/µL) = A260 × factor (dsDNA 50, RNA 40, ssDNA 38) × dilution ÷ path (cm); copies/µL = c (g/µL) ÷ M (g/mol) × 6.02214076 × 10²³. Example: A260 0.75 at 1 cm: 0.75 × 50 = 37.5 ng/µL dsDNA; for a 3,000 bp plasmid (1.98559 × 10⁶ g/mol) that is 1.137 × 10¹⁰ copies/µL. - [Tauc plot band gap calculator (UV–vis)](https://www.labcanvas.com/tools/tauc-plot-band-gap-calculator) (updated 2026-11-08): Convert each wavelength to photon energy (E = 1240/λ, E in eV, λ in nm), plot (αhν)² against hν for a direct allowed transition or (αhν)^½ for an indirect one, fit a straight line to the steep part of the absorption edge and extend it to the energy axis: the intercept is the optical band gap Eg. Paste your spectrum and the calculator does the plot, the fit and the intercept. Formula: E (eV) = 1240 ÷ λ (nm); plot (αhν)^(1/n) against hν, n = ½ direct, n = 2 indirect; Eg = intercept of the linear fit with the energy axis. Example: For the built-in synthetic direct-gap spectrum, (αhν)² fitted from 3.196 to 3.388 eV meets the axis at Eg = 3.19 eV, and 3.20 eV after subtracting a 0.02 baseline. - [Graphene Raman layer checker: monolayer, few-layer or multilayer](https://www.labcanvas.com/tools/graphene-raman-layer-calculator) (updated 2026-11-08): Monolayer graphene on Si/SiO₂ has a single-Lorentzian 2D band with a full width at half maximum of 35 cm⁻¹ or less and a 2D peak at least twice as high as the G peak: these are the UK National Physical Laboratory (NPL) criteria. Enter the 2D width, the I(2D)/I(G) ratio and the 2D line shape from your fit, and the checker compares them with the NPL criteria and the published layer trends. It is an indication, not proof. Formula: Monolayer (NPL, Si/SiO₂): single-Lorentzian 2D with FWHM(2D) ≤ 35 cm⁻¹ and I(2D)/I(G) ≥ 2; defect type from I(D)/I(D′) ≈ 13 sp³, 7 vacancy, 3.5 boundary. Example: A single-Lorentzian 2D band with FWHM 28 cm⁻¹ and I(G)/I(2D) = 0.28 (I(2D)/I(G) = 3.57) meets both criteria: consistent with monolayer graphene. - [RHE converter: reference electrode to reversible hydrogen electrode](https://www.labcanvas.com/tools/rhe-calculator) (updated 2026-11-08): A potential measured against a reference electrode is put on the reversible hydrogen electrode (RHE) scale with E(RHE) = E(ref) + E°(ref) + 0.059·pH at 25 °C, where E°(ref) is the reference electrode’s potential against SHE (about 0.2 V for Ag/AgCl). Subtract the iR drop (current × uncompensated resistance) for the iR-free potential; the OER overpotential is then E(RHE) − 1.23 V and the HER overpotential is E(RHE) − 0 V. Formula: E(RHE) = E(ref) + E°(ref) + 0.059 × pH (25 °C); iR-free E = E − i·Rs; η(OER) = E(RHE) − 1.23 V. Example: 0.45 V vs Ag/AgCl (saturated KCl, 0.199 V) in 1 M KOH (pH 14): 0.45 + 0.199 + 0.05916 × 14 = 1.477 V vs RHE, an OER overpotential of 247 mV. - [Tafel slope and exchange current density calculator](https://www.labcanvas.com/tools/tafel-slope-calculator) (updated 2026-11-08): A Tafel slope is found by plotting the overpotential η against log10 of the current density and fitting a straight line, η = a + b·log10|j|, over the linear part: b is the Tafel slope in mV per decade, and where the line reaches η = 0 it gives the exchange current density, log10 j₀ = −a/b. Paste your polarisation data, pick the range, and the calculator returns b, j₀ and R² with the plot. Formula: η = a + b × log₁₀|j|; Tafel slope = b (mV/dec); log₁₀ j₀ = −a ÷ b. Example: The built-in OER curve fitted over |η| = 260–320 mV gives b = 79.4 mV/dec and a = 236.9 mV, so j₀ = 10^(−236.9/79.4) = 1.04 × 10⁻³ mA cm⁻². - [Faradaic efficiency calculator for gas and liquid products](https://www.labcanvas.com/tools/faradaic-efficiency-calculator) (updated 2026-11-08): Faradaic efficiency is the fraction of the charge passed that ends up in a product: FE = z·n·F / Q, with z the electrons per molecule, n the moles of product, F = 96 485 C/mol and Q the charge. For a gas product measured on-line by GC, the moles come from its volume fraction x in the outlet flow v, so FE = z·F·x·v·p / (R·T·I), with I the total current. Formula: FE = z·n·F ÷ Q, F = 96,485 C/mol; gas by GC: FE = z·F·x·v·p ÷ (R·T·I). Example: 10 mA for 1 hour passes 36 C; finding 120 µmol of H₂ gives FE = 2 × 120 × 10⁻⁶ × 96,485 ÷ 36 = 64.3 %. - [Molecular orbital diagram generator](https://www.labcanvas.com/tools/molecular-orbital-diagram-generator) (updated 2026-11-08): Pick a diatomic molecule or ion and the generator draws its molecular orbital (MO) diagram: the atomic orbitals of each atom at the sides, the bonding and antibonding molecular orbitals in the middle in the correct order, and the electrons filled by the aufbau principle, the Pauli principle and Hund’s rule. It gives the MO electron configuration, the bond order, (bonding − antibonding electrons) / 2, whether the species is paramagnetic or diamagnetic, and whether it is expected to exist. Download the diagram as SVG or PNG. Formula: Aufbau, Pauli and Hund’s rule filling; π2p below σ2p (s–p mixing) for Li₂–N₂, CO, CN⁻; bond order = (bonding − antibonding electrons) ÷ 2 (OpenStax Chemistry 2e, 8.4). Example: O₂ has 12 valence electrons: (σ2s)²(σ*2s)²(σ2p)²(π2p)⁴(π*2p)², bond order = (8 − 4) ÷ 2 = 2, paramagnetic with 2 unpaired electrons. - [CONSORT flow diagram generator](https://www.labcanvas.com/tools/consort-flow-diagram-generator) (updated 2026-11-08): Type the numbers from your randomised trial (assessed for eligibility, excluded with reasons, randomised, then for each arm allocated, received the intervention, discontinued, lost to follow-up and analysed) and the generator draws the CONSORT flow diagram with the four stages (enrolment, allocation, follow-up, analysis) as you type. It checks that the counts add up, follows the box wording of the CONSORT 2025 template (or CONSORT 2010), handles two or three arms, and exports an editable SVG, a 300 or 600 dpi PNG and plain text. Formula: CONSORT 2025 template (Hopewell et al., BMJ 2025): assessed = excluded + randomised; arms sum to randomised; analysed = allocated − lost to follow-up − excluded from analysis. Example: 412 assessed − 172 excluded = 240 randomised, 120 per arm; in the intervention arm 120 − 5 lost − 1 excluded = 114 analysed. - [PRISMA 2020 flow diagram generator](https://www.labcanvas.com/tools/prisma-flow-diagram-generator) (updated 2026-11-08): Enter the counts from your systematic review search (records from each database and register, duplicates and other records removed, records screened and excluded, reports sought, not retrieved, assessed and excluded with reasons, and the studies and reports included) and the generator draws the PRISMA 2020 flow diagram as you type. Switch on the “other methods” column for websites, organisations and citation searching. It checks that every step adds up, fills derived counts for you, and exports an editable SVG, a 300 or 600 dpi PNG and plain text. Formula: PRISMA 2020 template (Page et al., BMJ 2021): screened = identified − removed; sought = screened − excluded; assessed = sought − not retrieved; included = assessed − excluded. Example: 4012 records − 1236 duplicates − 14 others = 2762 screened; 2762 − 2601 = 161 sought, 154 assessed, 154 − 132 = 22 reports included. - [Coulombic efficiency calculator: CE per cycle, average CE and capacity retention](https://www.labcanvas.com/tools/coulombic-efficiency-calculator) (updated 2026-11-08): Coulombic efficiency (CE) is the capacity a cell gives back divided by the capacity put in during the same cycle. For a cathode half-cell or a full cell that is discharge / charge; for a lithium-metal or anode half-cell (Li||Cu) it is stripping / plating, the charge capacity over the discharge capacity. If every cycle keeps the same CE and nothing replaces the lost lithium, the capacity left after n cycles is CEⁿ: 99.7 % CE falls to 80 % after about 74 cycles, 99.9 % after about 223. Paste your cycling data to get the CE of every cycle, the average over the cycles you choose, the first-cycle loss and the retention. Formula: CE = Q_out ÷ Q_in (discharge ÷ charge for cathode or full cell; charge ÷ discharge for anode or Li-metal half-cell); retention ≈ ICE × CEⁿ. Example: A cathode half-cell charging 228.4 and discharging 201.6 mAh g⁻¹ in cycle 1 has CE = 201.6 ÷ 228.4 = 88.27 %, a first-cycle loss of 26.8 mAh g⁻¹. - [Ionic conductivity calculator from impedance (EIS)](https://www.labcanvas.com/tools/ionic-conductivity-calculator) (updated 2026-11-08): Ionic conductivity from impedance is σ = L / (R·A), with L the thickness of the electrolyte between two blocking electrodes, A the electrode area and R its resistance, read from the Nyquist plot where the impedance meets the real axis. For a solid electrolyte, fit a circle through the arc: its high-frequency end gives the bulk resistance when the bulk arc lies above the measured frequencies, and its low-frequency end the total (bulk + grain boundary). With several temperatures, the slope of ln(σT) or log σ against 1000/T gives the activation energy Ea. Formula: σ = L ÷ (R·A), A = π·d² ÷ 4; Ea = −slope × 1000 × k from ln(σT) vs 1000/T, k = 8.617 × 10⁻⁵ eV/K. Example: A 1.05 mm pellet between 10 mm electrodes (0.7854 cm²) with R = 357.04 Ω: σ = 0.105 ÷ (357.04 × 0.7854) = 3.744 × 10⁻⁴ S/cm (0.3744 mS/cm). - [BET surface area calculator with the consistency (Rouquerol) criteria](https://www.labcanvas.com/tools/bet-surface-area-calculator) (updated 2026-11-08): The BET surface area is the monolayer capacity n_m times Avogadro’s number times the cross-sectional area of the adsorbate (0.162 nm² for N₂ at 77 K). n_m and the BET constant C come from a straight-line fit of 1/[n((p₀/p) − 1)] against p/p₀, usually between 0.05 and 0.30: n_m = 1/(slope + intercept) and C = 1 + slope/intercept. For microporous materials such as MOFs and activated carbons, pick the range with the consistency (Rouquerol) criteria: C positive, n(1 − p/p₀) rising over the range, and the p/p₀ at n_m inside it. Paste your isotherm and the calculator does the fit, checks the criteria and can find the longest range that passes them. Formula: Fit x ÷ [n(1 − x)] against x = p/p₀: n_m = 1 ÷ (slope + intercept), C = 1 + slope ÷ intercept; S (m²/g) = n_m (mmol/g) × 602.214 × σ (nm²). Example: With n_m = 5 mmol/g and N₂ (σ = 0.162 nm²): S = 5 × 602.214 × 0.162 = 487.8 m²/g. - [Microscope pixel size calculator: µm per pixel and ImageJ Set Scale](https://www.labcanvas.com/tools/microscope-pixel-size-calculator) (updated 2026-11-08): Pixel size in the specimen = camera pixel size × binning ÷ total magnification: a 6.5 µm camera pixel behind a 20× objective covers 0.325 µm (3.077 pixels per µm). To measure it instead, photograph a stage micrometer and divide the known distance by its length in pixels; for an SEM or TEM image, divide the horizontal field width by the image width in pixels. The calculator gives µm per pixel, pixels per µm, the field of view, whether the pixel meets Nyquist sampling, and what to type into ImageJ’s Analyze › Set Scale. Formula: pixel size = camera pixel × binning ÷ total magnification; or known distance ÷ pixels; Nyquist: pixel ≤ r ÷ 2, r = 0.61 λ ÷ NA. Example: A 6.5 µm camera pixel behind a 20× objective without binning: 6.5 ÷ 20 = 0.325 µm per pixel (3.077 pixels per µm). - [ASTM E112 grain size number calculator](https://www.labcanvas.com/tools/astm-grain-size-calculator) (updated 2026-11-08): The ASTM E112 grain size number is G = 3.321928·log₁₀(N_A) − 2.954, with N_A the number of grains per mm² (1 ÷ the mean grain area in mm²), or G = −6.643856·log₁₀(ℓ̄) − 3.288 from the mean lineal intercept ℓ̄ in mm. Both follow from the definition N = 2^(G − 1) grains per square inch at 100×, so a higher G means smaller grains: a mean intercept of 20 µm is G 8.0. Enter a mean grain area from image analysis, a grain count, an intercept length or G itself. Formula: G = 3.321928 × log₁₀(N_A) − 2.954 (N_A grains/mm²); G = −6.643856 × log₁₀(ℓ̄) − 3.288 (ℓ̄ in mm); N = 2^(G − 1) per in² at 100×. Example: Test lines totalling 2 mm cross 100 grains, so ℓ̄ = 0.020 mm and G = −6.643856 × log₁₀(0.020) − 3.288 = 8.0. - [Michaelis–Menten calculator: Km, Vmax, kcat and kcat/Km](https://www.labcanvas.com/tools/michaelis-menten-calculator) (updated 2026-10-19): Paste substrate concentrations and initial rates (with replicates) and the calculator fits v = Vmax·[S]/(Km + [S]) by nonlinear least squares. It gives Km and Vmax with standard errors, 95% confidence intervals and R², kcat and kcat/Km when you enter the enzyme concentration, the fitted curve over your data, and a Lineweaver–Burk plot of the same data for comparison. A substrate-inhibition model can be fitted and tested against plain Michaelis–Menten. Formula: v = Vmax·[S] / (Km + [S]); kcat = Vmax / [E]; catalytic efficiency = kcat / Km Example: Eight substrate concentrations from 2.5 to 320 µM in triplicate give Km = 16.74 ± 0.67 µM and Vmax = 1.153 ± 0.012 µM/min (R² = 0.9948). With 10 nM enzyme, kcat = 1.92 s⁻¹ and kcat/Km = 1.15 × 10⁵ M⁻¹ s⁻¹. - [BCA and Bradford protein assay standard curve calculator](https://www.labcanvas.com/tools/protein-assay-standard-curve) (updated 2026-10-19): Enter the absorbance of your BSA standards (A562 for BCA, A595 for Bradford, with replicates) and of your samples with their dilution factors. The calculator subtracts the blank, fits a quadratic or linear standard curve, reads each sample’s protein concentration off the curve, multiplies it by the dilution factor and flags samples outside the standard range. Preset standard series for the BCA (25–2000 µg/mL) and Bradford (125–2000 µg/mL) assays can be edited. Formula: Net A = A − mean(A blank); net A = a + b·c + q·c² → c = (−b + √(b² − 4q(a − net A))) / 2q; protein = c × dilution Example: BCA standards 25–2000 µg/mL fitted with a quadratic (R² = 0.9999): a lysate with net A562 = 0.851, diluted 5-fold, reads 643.5 µg/mL in the well, so 3217 µg/mL (3.2 mg/mL) in the lysate. - [Kaplan–Meier survival curve maker with log-rank test](https://www.labcanvas.com/tools/kaplan-meier-plot) (updated 2026-10-19): Paste one row per subject with the time, the event (1 = event, 0 = censored) and, optionally, a group. The tool draws the Kaplan–Meier (product-limit) survival curves with censoring ticks, a 95% confidence band and the number-at-risk table under the plot. It reports the median survival with its 95% confidence interval, Greenwood standard errors, the log-rank test P value between groups and the hazard ratio of two groups, and exports the figure as PNG or SVG and the tables as CSV. Formula: S(t) = Π over tᵢ ≤ t of (1 − dᵢ/nᵢ); Var[Ŝ(t)] = Ŝ(t)² · Σ dᵢ / (nᵢ(nᵢ − dᵢ)) (Greenwood); log-rank χ² = (O − E)² / V Example: In the AML maintenance trial (11 maintained, 12 not), survival at 18 weeks in the maintained group is 10/11 × 9/10 × 7/8 = 0.716 (SE 0.140); median remission is 31 weeks vs 23 weeks, log-rank χ² = 3.40, P = 0.065. - [Volcano plot maker for differential expression](https://www.labcanvas.com/tools/volcano-plot-maker) (updated 2026-10-19): Paste a differential-expression table (gene, log2 fold change, p-value, and the adjusted p-value if you have it) from DESeq2, edgeR, limma, proteomics or any t-tests. Set the fold-change and p or FDR thresholds, and the tool draws a volcano plot of log2 fold change against −log10 p, colours up-regulated, down-regulated and non-significant genes, labels the top genes and counts the hits. If you only have raw p-values it computes Benjamini–Hochberg adjusted p-values. Download the plot as SVG or 300 dpi PNG and the significant genes as CSV. Formula: Up: log2FC ≥ t and p_adj < α; down: log2FC ≤ −t and p_adj < α; BH p_adj(i) = min over j ≥ i of p₍ⱼ₎ · m / j (p sorted ascending, m tests); y = −log10 p. Example: In the built-in table of 1,000 genes, FDR < 0.05 and |log2FC| ≥ 1 give 25 up and 16 down; the top gene has p = 3.42 × 10⁻¹² and p_adj = 3.42 × 10⁻¹² × 1000 / 1 = 3.42 × 10⁻⁹. - [Heatmap maker with hierarchical clustering](https://www.labcanvas.com/tools/heatmap-maker) (updated 2026-10-19): Paste a matrix with row and column labels, such as genes by samples, and the tool draws a heatmap. It can scale each row to z-scores, cluster rows and columns by average-linkage hierarchical clustering with Euclidean or 1 − Pearson correlation distance and draw the dendrograms, colour the cells with a colour-blind-safe scale (viridis, cividis, blue–white–red or purple–white–orange) and show the values in the cells. Download the heatmap as SVG or 300 dpi PNG and the reordered matrix as CSV. Formula: z = (x − row mean) / row SD (n − 1); distance = √Σ(xᵢ − yᵢ)² or 1 − Pearson r; average linkage d(A∪B, C) = (|A|·d(A, C) + |B|·d(B, C)) / (|A| + |B|). Example: VEGFA at 6.1, 6.3, 5.9, 6.2 (control) and 8.4, 8.9, 8.6, 8.2 (hypoxia) has mean 7.325 and SD 1.302, so its first control sample has z = (6.1 − 7.325) / 1.302 = −0.94. - [Box plot and violin plot maker with statistics](https://www.labcanvas.com/tools/box-plot-maker) (updated 2026-10-19): Paste your groups (one column each, straight from Excel) and the tool draws a box plot (median, quartiles, 1.5 × IQR whiskers and outliers) or a violin plot (Gaussian kernel density) with every data point shown. It tests the groups: Welch’s t-test or the Mann–Whitney U test for two groups, one-way ANOVA with Tukey–Kramer or Kruskal–Wallis with Dunn’s test for three or more, and adds significance brackets with stars or p-values. A summary table gives n, mean, SD, SEM, median and IQR, and the plot downloads as SVG or 300 dpi PNG. Formula: Box: Q1, median, Q3 (linear interpolation), whiskers to the last point within 1.5 × IQR; violin: Gaussian KDE, h = 0.9 · min(SD, IQR/1.34) · n^(−1/5); Welch t = (x̄₁ − x̄₂) / √(s₁²/n₁ + s₂²/n₂). Example: Tumour volumes of 8 vehicle mice (mean 983 mm³, SD 183.6) vs 8 Drug A mice (mean 667.5, SD 84.0): Welch t(9.80) = 4.42, p = 0.0014; Mann–Whitney U = 63, exact p = 0.00031. - [Which statistical test should I use?](https://www.labcanvas.com/tools/statistical-test-chooser) (updated 2026-10-19): Answer a few questions about your experiment: what you want to do (compare groups, relate two variables, predict an outcome or compare survival), what kind of data you measured, how many groups, whether they are independent or paired, whether the data look normal and how large the sample is. The guide recommends the test, explains why, lists its assumptions and gives the non-parametric (or parametric) alternative. It covers t-tests, Mann–Whitney, Wilcoxon signed-rank, one-way and repeated-measures ANOVA, Kruskal–Wallis, Friedman, chi-square, Fisher’s exact, McNemar, Pearson and Spearman correlation, linear and logistic regression and the log-rank test, with a full table below. Formula: 2 groups: Welch t (normal) or Mann–Whitney (not); paired: paired t or Wilcoxon; 3+ groups: ANOVA or Kruskal–Wallis (paired: repeated-measures ANOVA or Friedman); counts: χ² (expected ≥ 5) or Fisher’s exact; paired yes/no: McNemar. Example: Comparing tumour volume between 2 independent groups of 8 mice, not normally distributed → Mann–Whitney U test (e.g. U = 63 of 64, exact p = 0.00031 for the box plot maker’s example). - [Journal figure size and DPI checker and resizer](https://www.labcanvas.com/tools/journal-figure-size) (updated 2026-10-19): A journal figure needs width in inches × dpi pixels across: a Nature single-column figure is 89 mm wide, 89 ÷ 25.4 = 3.504 inches, so at 300 dpi it needs 1051 pixels. Choose a journal, a column width and the kind of image (photo, combination or line art), open your PNG, JPEG or TIFF, and the tool shows its pixel size, the DPI the file records, the DPI it would have at that width and whether it has enough pixels. It then resamples the image to exactly that width, or only rewrites the DPI, and saves a PNG with the DPI recorded so it is placed at the right size. Formula: pixels = width (mm) ÷ 25.4 × dpi; dpi at a width = pixels ÷ (width (mm) ÷ 25.4) Example: Nature single column, 89 mm at 300 dpi: 89 ÷ 25.4 = 3.504 in × 300 = 1051 px, so an 1800 × 1350 px figure (513.7 dpi at 89 mm) is resampled to 1051 × 788 px. - [Add a scale bar to a microscope image](https://www.labcanvas.com/tools/scale-bar-adder) (updated 2026-10-19): A scale bar is its length divided by the pixel size: at 0.325 µm per pixel a 100 µm bar is 100 ÷ 0.325 = 307.7 pixels long. Open a micrograph (PNG, JPEG or TIFF), give the pixel size, read it from an ImageJ TIFF, or draw a line over something of known length such as an existing scale bar or stage micrometer and type its length. The tool picks a 1, 2 or 5 × 10ⁿ length that covers about 15–25 % of the width, or uses yours, and draws the bar with its label in the corner, colour, thickness and size you choose, with an optional box behind it. The PNG keeps the image’s pixel size and DPI, and nothing is uploaded. Formula: bar (px) = bar length (µm) ÷ pixel size (µm/px); pixel size = known length ÷ line length (px) Example: A 1600 × 1200 px image at 0.325 µm per pixel is 520 µm wide; the automatic bar is 100 µm (19.2 % of the width), drawn 100 ÷ 0.325 = 307.7 ≈ 308 px long. - [Gel and western blot lane labeller](https://www.labcanvas.com/tools/gel-lane-labeler) (updated 2026-10-19): Open a gel or blot image, set the number of lanes and the tool splits the image into equal lanes (centres at x₀ + (i + ½) × lane width), which you then drag onto the real lanes. Type a label for each lane, horizontal or angled above it, and add a molecular-weight marker column: pick PageRuler Plus, PageRuler, Precision Plus Protein, GeneRuler 1 kb or NEB 100 bp (band sizes as the manufacturers list them) and drag each mark onto its band, or type your own sizes and positions. Rotate to straighten a tilted gel, crop, and download a PNG or an SVG whose labels stay editable text. The image stays in your browser. Formula: lane centre xᵢ = x₀ + (i + ½)(x₁ − x₀)/n; first ladder guess y = y_top + (ln M_top − ln M)/(ln M_top − ln M_bottom) × (y_bottom − y_top) Example: 8 lanes across x = 50–850 px are 100 px wide with centres at 100, 200 … 800 px; with PageRuler Plus from 250 kDa at y = 60 to 10 kDa at y = 470, the 55 kDa mark starts at y = 252.9 px. - [Chemical equation balancer](https://www.labcanvas.com/tools/chemical-equation-balancer) (updated 2026-10-19): Type an unbalanced equation such as Fe + O2 -> Fe2O3 and the balancer returns the smallest whole-number coefficients, here 4Fe + 3O₂ → 2Fe₂O₃, with a table showing that every element (and the charge) is the same on both sides. It handles brackets, hydrates (CuSO4·5H2O), ions (Fe3+, SO4^2-) and electrons (e-) for redox half-equations, solves the balance exactly with fractions rather than trial and error, and tells you when an equation cannot be balanced or has no unique balance. The result is typeset with mhchem and can be copied as text or LaTeX \ce{…}, or downloaded as PNG or SVG. Formula: Find the nullspace of the element (and charge) matrix A: A·ν = 0, reactant columns +, product columns −, solved exactly with fractions and scaled to coprime integers. Example: KMnO4 + HCl = KCl + MnCl2 + H2O + Cl2 balances to 2KMnO₄ + 16HCl → 2KCl + 2MnCl₂ + 8H₂O + 5Cl₂ (K 2 = 2, Mn 2 = 2, O 8 = 8, H 16 = 16, Cl 16 = 16). - [Plasmid map maker](https://www.labcanvas.com/tools/plasmid-map-maker) (updated 2026-10-19): Enter the plasmid name and size in bp, list the features (name, start, end, strand and type: gene, promoter, origin, resistance marker, MCS or terminator) and any restriction sites, and the tool draws a circular plasmid map with direction arrows, bp tick marks and labels placed outside the circle so they never overlap, plus an optional linear map. You can import the features from a GenBank file (including complement() and join() locations) and find unique restriction sites in the sequence. Download the map as SVG for figures or as a high-resolution PNG. It opens with pUC19 (2686 bp). Formula: Angle = 360° × (position − 1) / plasmid size, clockwise from the top; forward (+) features point clockwise, reverse (complement) features anticlockwise. Example: pUC19 (2686 bp): AmpR (bla) at complement(1626..2486) spans 861 bp, an arc of 360° × 861 / 2686 = 115.4°; the MCS holds EcoRI at 396 and HindIII at 447. - [Sample size calculator (power analysis)](https://www.labcanvas.com/tools/sample-size-calculator) (updated 2026-10-19): For a two-sample t test with a medium effect (Cohen’s d = 0.5), α = 0.05 two-sided and 80% power you need 64 participants per group, 128 in total. Choose the test (two-sample t, paired t, two proportions, one-way ANOVA or correlation), enter the expected effect as an effect size or as means and SDs, proportions or group means, and set α, power, one- or two-sided and the allocation ratio. The calculator gives the smallest sample size that reaches the target power, or the power of a sample size you already have, with a power curve. t tests use the exact noncentral t distribution, the same calculation as G*Power and R’s pwr.t.test. Formula: Two-sample t: power = 1 − F_t(t₁₋α/₂; ν, δ) + F_t(−t₁₋α/₂; ν, δ), with ν = n₁ + n₂ − 2 and noncentrality δ = d·√(n₁n₂/(n₁ + n₂)); n is the smallest whole number reaching the target. Example: d = 0.5, α = 0.05 two-sided, power 0.8: n = 64 per group (ν = 126, δ = 2.828, power 0.8015); with 63 per group power is 0.7952. - [Concentration unit converter](https://www.labcanvas.com/tools/concentration-converter) (updated 2026-10-19): Enter one concentration in any unit, with the molar mass, and the converter shows it in every other unit at once: molarity (M, mM, µM, nM), mass concentration (g/L, mg/mL, µg/mL, ng/mL), % w/v, % w/w, ppm and ppb, molality, mole fraction and normality, each with its formula. For example, 150 mM NaCl (58.44 g/mol) is 8.766 g/L = 8.766 mg/mL = 0.8766 % w/v = 8766 ppm. Units based on the mass of solution or solvent (% w/w, molality, mole fraction) use the solution density, and ppm and ppb are taken as mg/L and µg/L for dilute aqueous solutions. Formula: ρ (g/L) = c (mol/L) × M; % w/v = ρ/10; % w/w = ρ/(10d); ppm = ρ × 1000 (mg/L); molality b = 1000c/(1000d − cM); x = c/(c + (1000d − cM)/Mₛ); N = c × eq. Example: 37% w/w HCl (M = 36.46 g/mol, density 1.19 g/mL) is 440.3 g/L = 12.08 M, 16.11 mol/kg, mole fraction 0.2249. ## Pages - [Features](https://www.labcanvas.com/features): Everything in the eight apps - [Pricing](https://www.labcanvas.com/pricing): The free plan (every app, up to 3 designs) and LabCanvas Pro (downloads, unlimited designs, AI), monthly or yearly - [Gallery](https://www.labcanvas.com/gallery): Editable scientific illustrations - [Tutorials](https://www.labcanvas.com/tutorials): Step-by-step guides - [Documentation](https://www.labcanvas.com/documentation): How each app works, export, shortcuts - [About us](https://www.labcanvas.com/about-us): The company and team behind LabCanvas - [Editorial guidelines](https://www.labcanvas.com/editorial-guidelines): How content is written and checked - [Statistics validation](https://www.labcanvas.com/statistics-validation): How the Graph app’s statistics are checked against R, SciPy, statsmodels and lifelines, the tolerances, and how to cite it - [Image analysis validation](https://www.labcanvas.com/image-analysis-validation): How the Image Analysis app’s measurements and assays are checked against scikit-image, SciPy, scikit-learn and tifffile and images with known answers, the tolerances, and how to cite it - [Contact](https://www.labcanvas.com/contact): Email and address - [Sitemap](https://www.labcanvas.com/sitemap): All pages - [Privacy Policy](https://www.labcanvas.com/privacy): How data is handled - [Terms of Service](https://www.labcanvas.com/terms): Terms of use ## App guides - [LabCanvas Image Analysis: measure microscopy images, western blots and gels in your browser](https://www.labcanvas.com/blog/image-analysis-microscopy-western-blot) ([Markdown](https://www.labcanvas.com/blog/image-analysis-microscopy-western-blot.md), updated 2026-11-08): How to measure images in LabCanvas Image Analysis: guided assays (nuclear translocation, spots per cell, wound healing, FRAP, calcium, tracking, branching), western blots with a ladder and total-protein normalisation, cell counting with a trainable classifier, ROIs with ImageJ definitions, on the raw pixel values, with results sent to Graphs. - [Image Analysis in LabCanvas: a complete guide to every tool and setting, with examples](https://www.labcanvas.com/blog/image-analysis-complete-guide) ([Markdown](https://www.labcanvas.com/blog/image-analysis-complete-guide.md), updated 2026-11-06): Every tool in LabCanvas Image Analysis, tab by tab, with its settings and a real example: image check, display and scale, stacks and Z projection, background subtraction, filters, thresholds and binary operations, ROIs and Set measurements, Analyze Particles, a pixel classifier, spots, cell counter, western blot densitometry, colocalisation, colour deconvolution and eleven guided assays. - [The LabCanvas Figure editor: vector scientific illustration in your browser](https://www.labcanvas.com/blog/figure-editor-scientific-illustration) ([Markdown](https://www.labcanvas.com/blog/figure-editor-scientific-illustration.md), updated 2026-11-08): How to make journal figures and graphical abstracts in the LabCanvas Figure editor: vector tools, 700+ adjustable science objects, lab glassware that connects, LaTeX equations, and export at the width and DPI your journal asks for. - [LabCanvas Slides: scientific presentations built from editable figures](https://www.labcanvas.com/blog/slides-scientific-presentations) ([Markdown](https://www.labcanvas.com/blog/slides-scientific-presentations.md), updated 2026-11-08): How to build lab meetings, conference talks and lectures in LabCanvas Slides: a slide strip, layouts and themes, transitions and motion paths, speaker notes, full-screen presenting and a vector PDF of the deck. - [LabCanvas Research Poster: conference posters that arrange themselves](https://www.labcanvas.com/blog/research-poster-maker) ([Markdown](https://www.labcanvas.com/blog/research-poster-maker.md), updated 2026-11-08): How to make an A0, A1 or 48 × 36 in research poster in LabCanvas Research Poster: blocks that stack in columns and re-flow their text, themes and block styles, QR codes, and a print-ready vector PDF. - [MolDraw online: free chemical structure drawing in your browser](https://www.labcanvas.com/blog/moldraw-chemical-structure-drawing) ([Markdown](https://www.labcanvas.com/blog/moldraw-chemical-structure-drawing.md), updated 2026-11-08): Draw molecules and reaction schemes online, free, with nothing to install. LabCanvas MolDraw: atoms, bonds, rings and charges, reaction arrows, structures from PubChem, SMILES, a 3D view of the same molecule, and placing structures in figures. - [The LabCanvas 3D Studio: adjustable 3D models of cells, nanomaterials and devices](https://www.labcanvas.com/blog/3d-studio-scientific-3d-models) ([Markdown](https://www.labcanvas.com/blog/3d-studio-scientific-3d-models.md), updated 2026-11-08): How to make 3D scientific renders in the LabCanvas 3D Studio: adjustable models of cells, viruses, nanoparticles, 2D materials, MOFs and devices, molecules from PubChem, proteins from the PDB, crystals from CIF files, and renders placed in figures. - [The LabCanvas Protein viewer: PDB structures styled for figures](https://www.labcanvas.com/blog/protein-viewer-pdb-structures) ([Markdown](https://www.labcanvas.com/blog/protein-viewer-pdb-structures.md), updated 2026-11-08): How to show a protein structure in the LabCanvas Protein viewer: load any PDB ID or your own PDB and mmCIF file, choose cartoon, surface or ball-and-stick, colour by chain or secondary structure, select residues on the sequence and snapshot a transparent PNG for your figure. - [LabCanvas Graphs & statistics: 70 scientific graph types with checked statistics](https://www.labcanvas.com/blog/graphs-statistics-scientific-plots) ([Markdown](https://www.labcanvas.com/blog/graphs-statistics-scientific-plots.md), updated 2026-11-08): A visual guide to LabCanvas Graphs & statistics: Prism-style data tables, 70 graph types from scatter dot plots to Kaplan–Meier, volcano and PAE plots, t tests, ANOVA, curve fits and survival tests checked against SciPy, and graphs that stay linked to their figure. - [LabCanvas Optics: draw optical setups with the beam path simulated live](https://www.labcanvas.com/blog/optics-optical-setup-simulator) ([Markdown](https://www.labcanvas.com/blog/optics-optical-setup-simulator.md), updated 2026-11-08): How to build optical setup diagrams in LabCanvas Optics: lasers, lenses, mirrors, beam splitters, gratings and detectors on a breadboard, rays and beams traced as you move parts, interference, ready-made setups and clean schematics for figures. - [The LabCanvas Pixel editor: edit micrographs and photos inside your figure](https://www.labcanvas.com/blog/pixel-editor-microscopy-images) ([Markdown](https://www.labcanvas.com/blog/pixel-editor-microscopy-images.md), updated 2026-11-08): How to adjust microscopy images and photos in the LabCanvas Pixel editor: crop, levels, curves and exposure, false-colour lookup tables, healing and clone stamp, selections and masks, with an edit log for your methods section. ## Guides - [Crystal structure and 2D-material figures: VESTA, Mercury, CrystalMaker, Avogadro, OVITO and LabCanvas compared](https://www.labcanvas.com/blog/crystal-structure-visualization-software) ([Markdown](https://www.labcanvas.com/blog/crystal-structure-visualization-software.md), updated 2026-11-08): Which tool for crystal structure and 2D-material figures? VESTA, CrystalMaker, Mercury, Avogadro, Jmol, OVITO, the Materials Project viewer and LabCanvas compared: licence, platforms, file formats, rendering and how to cite each. - [Free tools for scientific figures in 2026: BioRender, Inkscape, Affinity, Canva, PowerPoint and more](https://www.labcanvas.com/blog/free-tools-scientific-figures) ([Markdown](https://www.labcanvas.com/blog/free-tools-scientific-figures.md), updated 2026-11-08): An honest comparison of tools for scientific figures: BioRender, Mind the Graph, Inkscape, Affinity, Canva, PowerPoint, Adobe Illustrator and LabCanvas. What each free plan includes, publication rights, file formats and who each one suits. - [Journal figure size guide: column widths, DPI and fonts for 38 journals](https://www.labcanvas.com/blog/journal-figure-size-guide) ([Markdown](https://www.labcanvas.com/blog/journal-figure-size-guide.md), updated 2026-11-08): Figure requirements for 38 journals in one table: single, 1.5 and double column widths in mm, maximum height, DPI for photos and line art, fonts and file types, each linked to the journal’s author guidelines. - [A free GraphPad Prism alternative: graphs and statistics in your browser](https://www.labcanvas.com/blog/graphpad-prism-alternative) ([Markdown](https://www.labcanvas.com/blog/graphpad-prism-alternative.md), updated 2026-11-08): Looking for a free GraphPad Prism alternative? What LabCanvas Graphs does (data tables, t tests, ANOVA, curve fits, survival, cluster analysis, 70 graph types checked against SciPy), what it does not, and when Prism is still the better choice. - [What is LabCanvas? One workspace for scientific illustration, data and presentation](https://www.labcanvas.com/blog/what-is-labcanvas) ([Markdown](https://www.labcanvas.com/blog/what-is-labcanvas.md), updated 2026-11-08): A guide to LabCanvas: ten connected apps for figures, molecules, 3D crystals, graphs, slides and posters, the workflows between them, ready-made templates, and why one editable canvas makes scientific illustration faster to learn and easier to change. - [A BioRender alternative for scientific figures: what LabCanvas does differently](https://www.labcanvas.com/blog/biorender-alternative) ([Markdown](https://www.labcanvas.com/blog/biorender-alternative.md), updated 2026-11-08): Looking for a BioRender alternative? An honest comparison with LabCanvas: adjustable objects, vector tools, 3D and graphs, and when BioRender fits better. ## Image analysis how-tos How to measure microscope images, electron micrographs, blots and gels: the steps in ImageJ and Fiji, then the same job in LabCanvas Image Analysis ([all of them](https://www.labcanvas.com/blog/image-analysis)). - [ImageJ vs LabCanvas Image Analysis: an honest comparison](https://www.labcanvas.com/blog/imagej-vs-labcanvas) ([Markdown](https://www.labcanvas.com/blog/imagej-vs-labcanvas.md), updated 2026-11-08): ImageJ/Fiji or LabCanvas Image Analysis? Six everyday jobs done in both, six newer ones (macros, vendor files, 3D, StarDist, big images) and which to use. - [How to use ImageJ: a beginner's tutorial for the 10 everyday jobs (2026)](https://www.labcanvas.com/blog/how-to-use-imagej) ([Markdown](https://www.labcanvas.com/blog/how-to-use-imagej.md), updated 2026-11-06): How to use ImageJ and Fiji: get started, open an image, then 10 everyday jobs (scale, measure, threshold, count, background, blots) with exact menu paths. - [How to set the scale and add a scale bar in ImageJ (with a calibration image to practise on)](https://www.labcanvas.com/blog/imagej-scale-bar-set-scale) ([Markdown](https://www.labcanvas.com/blog/imagej-scale-bar-set-scale.md), updated 2026-11-06): Set the scale in ImageJ (Analyze › Set Scale) from a micrometer, scale bar or pixel size, add a scale bar, and practise on a free calibration image. - [Western blot quantification in ImageJ, step by step (and the 3-click way)](https://www.labcanvas.com/blog/western-blot-quantification-imagej) ([Markdown](https://www.labcanvas.com/blog/western-blot-quantification-imagej.md), updated 2026-11-06): Quantify a western blot in ImageJ with Analyze › Gels, normalise to a loading control or total protein, and get fold change. Plus a 3-click way. - [How to count cells in ImageJ (automatic and manual)](https://www.labcanvas.com/blog/count-cells-imagej) ([Markdown](https://www.labcanvas.com/blog/count-cells-imagej.md), updated 2026-11-06): Count cells in ImageJ: automatic (threshold, Watershed, Analyze Particles) or manual (Cell Counter, Multi-point), plus cells per mm² and % positive. - [How to measure length and area in ImageJ (with the right units)](https://www.labcanvas.com/blog/measure-length-area-imagej) ([Markdown](https://www.labcanvas.com/blog/measure-length-area-imagej.md), updated 2026-11-06): Measure length and area in ImageJ: set the scale, draw lines or area selections (polygon, wand, threshold), press Measure, and get µm and µm², not pixels. - [Grain size analysis in ImageJ (SEM, ASTM E112) + grain size number calculator](https://www.labcanvas.com/blog/grain-size-analysis-sem) ([Markdown](https://www.labcanvas.com/blog/grain-size-analysis-sem.md), updated 2026-11-06): Measure grain size from SEM images in ImageJ: closed boundaries, Analyze Particles, then ASTM E112 G from mean area or intercept, with a worked example. - [How to measure leaf area with ImageJ (or from a phone photo, in the browser)](https://www.labcanvas.com/blog/leaf-area-imagej) ([Markdown](https://www.labcanvas.com/blog/leaf-area-imagej.md), updated 2026-11-06): Measure leaf area in ImageJ from a photo or scan: set the scale from a ruler, threshold the leaf, run Analyze Particles in cm², with or without holes. - [ImageJ online: can you run it in a browser? (ImageJ.JS, and a faster way)](https://www.labcanvas.com/blog/imagej-online) ([Markdown](https://www.labcanvas.com/blog/imagej-online.md), updated 2026-11-06): Yes: ImageJ.JS runs ImageJ 1.x in your browser via CheerpJ (WebAssembly). What works, what doesn't, Fiji online, iPad and Android, and a faster option. - [Best ImageJ alternatives in 2026 (free, online and desktop)](https://www.labcanvas.com/blog/imagej-alternatives) ([Markdown](https://www.labcanvas.com/blog/imagej-alternatives.md), updated 2026-11-06): The best ImageJ alternatives compared: browser tools, Fiji, CellProfiler, QuPath, ilastik, napari, Icy, MIPAR, and Image Lab and Empiria for blots. - [Lateral size of 2D flakes (graphene, MoS₂) from SEM or TEM in ImageJ](https://www.labcanvas.com/blog/2d-flake-lateral-size) ([Markdown](https://www.labcanvas.com/blog/2d-flake-lateral-size.md), updated 2026-11-06): Measure graphene or MoS₂ flake lateral size in ImageJ: scale, threshold, Analyze Particles with Feret diameter, edge flakes, overlaps and a size histogram. - [Analyze Particles in ImageJ, explained (every option, with examples)](https://www.labcanvas.com/blog/analyze-particles-imagej) ([Markdown](https://www.labcanvas.com/blog/analyze-particles-imagej.md), updated 2026-11-06): Every Analyze Particles option in ImageJ, shown on a TEM image: size, circularity, Show, Exclude on edges, Include holes, and why it finds 0 or 1 particle. - [Calcium imaging analysis in ImageJ: ΔF/F₀ traces step by step](https://www.labcanvas.com/blog/calcium-imaging-delta-f-over-f) ([Markdown](https://www.labcanvas.com/blog/calcium-imaging-delta-f-over-f.md), updated 2026-11-06): Calcium imaging in ImageJ: ROIs on cells, Multi Measure, background, F₀ (first frames or a percentile), ΔF/F₀ = (F − F₀)/F₀, traces and peak counting. - [CellProfiler vs QuPath vs ImageJ: which image analysis software should you use?](https://www.labcanvas.com/blog/cellprofiler-vs-qupath-vs-imagej) ([Markdown](https://www.labcanvas.com/blog/cellprofiler-vs-qupath-vs-imagej.md), updated 2026-11-06): CellProfiler, QuPath or ImageJ/Fiji? A fair comparison by job (batch cell measurements, whole slides, general analysis), with a nuclei count step by step. - [Colocalization analysis in ImageJ: Pearson vs Manders and Costes thresholds](https://www.labcanvas.com/blog/colocalization-analysis-pearson-manders) ([Markdown](https://www.labcanvas.com/blog/colocalization-analysis-pearson-manders.md), updated 2026-11-06): Colocalization in ImageJ and Fiji: what Pearson’s r and Manders’ M1/M2 each answer, Costes thresholds, Coloc 2 vs JACoP, a worked example and pitfalls. - [Count bacterial colonies in ImageJ (or from a plate photo, free online)](https://www.labcanvas.com/blog/colony-counter-online) ([Markdown](https://www.labcanvas.com/blog/colony-counter-online.md), updated 2026-11-06): Count colonies in ImageJ: oval on the dish, threshold, Watershed, Analyze Particles. Then CFU/mL from the count and dilution, with a worked example. - [Measure contact angle from a drop photo in ImageJ](https://www.labcanvas.com/blog/contact-angle-imagej) ([Markdown](https://www.labcanvas.com/blog/contact-angle-imagej.md), updated 2026-11-06): Measure contact angle in ImageJ with the Angle tool along the tangent, or from drop height and base width: θ = 2·arctan(2h/d). Worked example, plugins. - [Count γH2AX or 53BP1 foci per nucleus in ImageJ (Find Maxima, step by step)](https://www.labcanvas.com/blog/count-foci-per-nucleus) ([Markdown](https://www.labcanvas.com/blog/count-foci-per-nucleus.md), updated 2026-11-06): Count γH2AX or 53BP1 foci per nucleus in ImageJ: nuclei as ROIs, Find Maxima with the right prominence, counts per nucleus and % of cells with ≥5 foci. - [How to measure d-spacing from HRTEM lattice fringes in ImageJ (profile and FFT)](https://www.labcanvas.com/blog/d-spacing-hrtem-lattice-fringes) ([Markdown](https://www.labcanvas.com/blog/d-spacing-hrtem-lattice-fringes.md), updated 2026-11-06): Measure d-spacing in ImageJ: a wide line across 10 fringes and Plot Profile (d = L ÷ N), or FFT spots read with Measure. Worked on Au (111), 0.235 nm. - [IHC DAB quantification in ImageJ with colour deconvolution](https://www.labcanvas.com/blog/dab-ihc-quantification) ([Markdown](https://www.labcanvas.com/blog/dab-ihc-quantification.md), updated 2026-11-06): Quantify DAB IHC in ImageJ/Fiji: colour deconvolution with H-DAB vectors, % positive area, optical density, and why DAB intensity is not linear. - [Feret diameter, circularity, aspect ratio and solidity in ImageJ, explained](https://www.labcanvas.com/blog/feret-diameter-circularity) ([Markdown](https://www.labcanvas.com/blog/feret-diameter-circularity.md), updated 2026-11-06): What ImageJ shape descriptors mean: Feret and MinFeret, circularity, AR, roundness and solidity, with formulas, drawn shapes and real TEM and SEM numbers. - [Deep-learning cell segmentation in Fiji: StarDist, Cellpose and Weka (step by step)](https://www.labcanvas.com/blog/fiji-stardist-cellpose-segmentation) ([Markdown](https://www.labcanvas.com/blog/fiji-stardist-cellpose-segmentation.md), updated 2026-11-06): When a threshold fails, segment cells in Fiji with StarDist, Cellpose or Trainable Weka: install, settings, then label image to ROIs and measurements. - [Stitch microscope tiles in Fiji (Grid/Collection stitching, step by step)](https://www.labcanvas.com/blog/fiji-stitching-tiles) ([Markdown](https://www.labcanvas.com/blog/fiji-stitching-tiles.md), updated 2026-11-06): Stitch overlapping microscope tiles in Fiji with Grid/Collection stitching: grid type, overlap, file names, fusion, and why an ImageJ montage is wrong. - [Fiji vs ImageJ: what's the difference, and which should you download?](https://www.labcanvas.com/blog/fiji-vs-imagej) ([Markdown](https://www.labcanvas.com/blog/fiji-vs-imagej.md), updated 2026-11-06): Fiji is ImageJ with plugins, Bio-Formats, an updater and scripting built in; ImageJ2 is the rewrite underneath. A comparison table and which to download. - [FRAP analysis in ImageJ: mobile fraction and half-time, step by step](https://www.labcanvas.com/blog/frap-analysis-mobile-fraction) ([Markdown](https://www.labcanvas.com/blog/frap-analysis-mobile-fraction.md), updated 2026-11-06): FRAP in ImageJ: bleach, reference and background ROIs, Multi Measure, double normalisation, an exponential recovery fit, then the mobile fraction and t½. - [Free western blot quantification software (now that Image Studio Lite is gone)](https://www.labcanvas.com/blog/free-western-blot-quantification-software) ([Markdown](https://www.labcanvas.com/blog/free-western-blot-quantification-software.md), updated 2026-11-06): Image Studio Lite is discontinued. Quantify western blots free in ImageJ (Analyze › Gels), step by step, with Image Lab and IOCBIO Gel compared. - [How to cite ImageJ and Fiji (with a methods sentence to copy)](https://www.labcanvas.com/blog/how-to-cite-imagej) ([Markdown](https://www.labcanvas.com/blog/how-to-cite-imagej.md), updated 2026-11-06): Cite ImageJ (Schneider et al. 2012), Fiji (Schindelin et al. 2012) or ImageJ2 (Rueden et al. 2017): DOIs, APA, Vancouver, BibTeX and methods sentences. - [3D projection and 3D viewing in ImageJ (Image › Stacks › 3D Project)](https://www.labcanvas.com/blog/imagej-3d-projection) ([Markdown](https://www.labcanvas.com/blog/imagej-3d-projection.md), updated 2026-11-06): Make a rotating 3D view of a Z-stack with Image › Stacks › 3D Project in ImageJ, set the slice spacing, use Orthogonal Views, or Fiji's 3D Viewer. - [Crop, rotate, resize and convert images in ImageJ (without changing your data by accident)](https://www.labcanvas.com/blog/imagej-basic-image-editing) ([Markdown](https://www.labcanvas.com/blog/imagej-basic-image-editing.md), updated 2026-11-06): How to crop, rotate, resize, zoom and convert to 8-bit or grayscale in ImageJ, and what each command does to pixel values and the scale, measured. - [Deconvolution in ImageJ and Fiji: what it does and how to run it](https://www.labcanvas.com/blog/imagej-deconvolution) ([Markdown](https://www.labcanvas.com/blog/imagej-deconvolution.md), updated 2026-11-06): What deconvolution does (the PSF, Richardson–Lucy), why FD Math Deconvolve fails on real images, and how to run Richardson–Lucy in ImageJ and Fiji. - [FFT bandpass filter and edge detection in ImageJ (with before/after examples)](https://www.labcanvas.com/blog/imagej-fft-bandpass-edge-detection) ([Markdown](https://www.labcanvas.com/blog/imagej-fft-bandpass-edge-detection.md), updated 2026-11-06): FFT in ImageJ step by step: Process › FFT, Bandpass Filter settings, stripe removal and Find Edges, with before/after pictures and when filtering is safe. - [Check for saturated pixels in ImageJ: histogram, HiLo LUT and the numbers](https://www.labcanvas.com/blog/imagej-histogram-saturation) ([Markdown](https://www.labcanvas.com/blog/imagej-histogram-saturation.md), updated 2026-11-06): Check saturation in ImageJ with Analyze › Histogram, the HiLo LUT and Min/Max, on a clipped example with its spike at 65535 and what it does to data. - [LUTs in ImageJ: which lookup table to use (and colour-blind-safe choices)](https://www.labcanvas.com/blog/imagej-lut) ([Markdown](https://www.labcanvas.com/blog/imagej-lut.md), updated 2026-11-06): ImageJ lookup tables compared on one image: Grays, Fire, viridis, HiLo and the rest, how to add a calibration bar, and colour-blind-safe channel colours. - [ImageJ and Fiji on a Mac: install, Apple Silicon and "can't be opened" fixes](https://www.labcanvas.com/blog/imagej-mac) ([Markdown](https://www.labcanvas.com/blog/imagej-mac.md), updated 2026-11-06): Download ImageJ or Fiji for Mac (Apple Silicon or Intel), fix "can't be opened" and "damaged" errors, set the memory, and the no-install option. - [ImageJ macros for beginners: record a macro and batch-process a folder](https://www.labcanvas.com/blog/imagej-macros-batch-processing) ([Markdown](https://www.labcanvas.com/blog/imagej-macros-batch-processing.md), updated 2026-11-06): Record an ImageJ macro with Plugins › Macros › Record, run it from the editor, then batch-process a folder with Process › Batch › Macro. Step by step. - [Make a movie from an image stack or time-lapse in ImageJ (AVI, GIF, MP4)](https://www.labcanvas.com/blog/imagej-make-movie-from-stack) ([Markdown](https://www.labcanvas.com/blog/imagej-make-movie-from-stack.md), updated 2026-11-06): Turn a folder of frames or a time-lapse stack into an AVI, GIF or MP4 in ImageJ: Image Sequence, a time stamp, a scale bar, frame rate, and saving. - [Plot Profile in ImageJ: line scans, wide lines and intensity profiles](https://www.labcanvas.com/blog/imagej-plot-profile) ([Markdown](https://www.labcanvas.com/blog/imagej-plot-profile.md), updated 2026-11-06): Plot Profile in ImageJ: draw a line, press Ctrl K, set the line width to average noise, copy the values, plot two channels and profile a rectangle. - [ROI Manager in ImageJ: measure many regions, save them and open them anywhere](https://www.labcanvas.com/blog/imagej-roi-manager) ([Markdown](https://www.labcanvas.com/blog/imagej-roi-manager.md), updated 2026-11-06): Open the ROI Manager in ImageJ (Analyze › Tools › ROI Manager), add ROIs with T, measure them on every channel, save RoiSet.zip and reopen it later. - [ImageJ threshold methods compared, with pictures](https://www.labcanvas.com/blog/imagej-threshold-methods) ([Markdown](https://www.labcanvas.com/blog/imagej-threshold-methods.md), updated 2026-11-06): All 16 ImageJ auto threshold methods on one image, with the threshold and % area each gives, which method suits which image, and how to apply it. - [Install ImageJ or Fiji on Windows 10 and 11](https://www.labcanvas.com/blog/imagej-windows) ([Markdown](https://www.labcanvas.com/blog/imagej-windows.md), updated 2026-11-06): Download and install Fiji or ImageJ on Windows 10 and 11: the right zip, where to unzip it (not Program Files), Java, memory, and where files go. - [How to make a kymograph in ImageJ and measure velocities](https://www.labcanvas.com/blog/kymograph-imagej) ([Markdown](https://www.labcanvas.com/blog/kymograph-imagej.md), updated 2026-11-06): Make a kymograph in ImageJ: a line along the track, Image › Stacks › Reslice, then a line on each streak gives velocity = Δx ÷ Δt, with a worked example. - [Z Project in ImageJ: maximum, average and sum projections compared](https://www.labcanvas.com/blog/maximum-intensity-projection) ([Markdown](https://www.labcanvas.com/blog/maximum-intensity-projection.md), updated 2026-11-06): Image › Stacks › Z Project in ImageJ: what Max Intensity, Average, Sum Slices, SD, Min and Median give, when Sum beats Max, and how to check depth. - [How to measure fluorescence intensity in ImageJ (Mean, IntDen, RawIntDen and CTCF)](https://www.labcanvas.com/blog/measure-fluorescence-intensity-imagej) ([Markdown](https://www.labcanvas.com/blog/measure-fluorescence-intensity-imagej.md), updated 2026-11-06): Measure fluorescence in ImageJ: Mean, IntDen and RawIntDen explained, CTCF = IntDen − Area × background worked through, and the 8-bit and saturation traps. - [Merge, split and overlay channels in ImageJ (and make a composite figure)](https://www.labcanvas.com/blog/merge-channels-imagej) ([Markdown](https://www.labcanvas.com/blog/merge-channels-imagej.md), updated 2026-11-06): Merge channels in ImageJ with Image › Color › Merge Channels, split them with Split Channels, overlay with Add Image, and build a colour-blind-safe figure. - [Image integrity: what you may and may not do to microscopy and blot images](https://www.labcanvas.com/blog/microscopy-image-integrity) ([Markdown](https://www.labcanvas.com/blog/microscopy-image-integrity.md), updated 2026-11-06): What journals allow when you adjust microscopy and blot images: linear whole-image changes, gamma disclosed, no cloning or selective edits, in ImageJ. - [Nanoparticle size distribution from TEM images in ImageJ (step by step)](https://www.labcanvas.com/blog/nanoparticle-size-distribution-tem) ([Markdown](https://www.labcanvas.com/blog/nanoparticle-size-distribution-tem.md), updated 2026-11-06): Nanoparticle size from TEM in ImageJ: scale, threshold, watershed, Analyze Particles with Feret, then the size histogram and mean ± SD, worked through. - [Nanorod and nanowire length, width and aspect ratio from SEM images in ImageJ](https://www.labcanvas.com/blog/nanowire-length-aspect-ratio-sem) ([Markdown](https://www.labcanvas.com/blog/nanowire-length-aspect-ratio-sem.md), updated 2026-11-06): Measure nanorod and nanowire length, width and aspect ratio from SEM images in ImageJ: Feret, MinFeret, fit ellipse, edge rods, and why not to watershed. - [Neurite length and branching in ImageJ: Skeletonize and Analyze Skeleton](https://www.labcanvas.com/blog/neurite-length-skeleton-analysis) ([Markdown](https://www.labcanvas.com/blog/neurite-length-skeleton-analysis.md), updated 2026-11-06): Neurite length and branching in ImageJ: threshold, Process › Binary › Skeletonize, then Analyze Skeleton (Fiji) or a macro. Why diagonal steps matter. - [Nuclear/cytoplasmic ratio in ImageJ: quantify NF-κB, YAP or TFEB translocation](https://www.labcanvas.com/blog/nuclear-cytoplasmic-ratio) ([Markdown](https://www.labcanvas.com/blog/nuclear-cytoplasmic-ratio.md), updated 2026-11-06): Measure the nuclear/cytoplasmic ratio in ImageJ step by step: nuclei from DAPI, a cytoplasm ring with Enlarge and Make Band, and an N/C table per cell. - [How to open .czi, .nd2, .lif and other microscope files in ImageJ (Bio-Formats)](https://www.labcanvas.com/blog/open-czi-nd2-files-imagej) ([Markdown](https://www.labcanvas.com/blog/open-czi-nd2-files-imagej.md), updated 2026-11-06): Open Zeiss .czi, Nikon .nd2 and Leica .lif files in ImageJ with Bio-Formats (built into Fiji), keep the pixel size, and fix "Unsupported format". - [Open DICOM files in ImageJ (and a series as a stack)](https://www.labcanvas.com/blog/open-dicom-imagej) ([Markdown](https://www.labcanvas.com/blog/open-dicom-imagej.md), updated 2026-11-06): Open DICOM files in ImageJ with File › Open, a whole series as a stack with Import › Image Sequence, read the tags, measure HU, and open compressed DICOM. - [Particle tracking in ImageJ (TrackMate) and MSD: a practical guide](https://www.labcanvas.com/blog/particle-tracking-msd) ([Markdown](https://www.labcanvas.com/blog/particle-tracking-msd.md), updated 2026-11-06): Track particles in ImageJ with TrackMate (Fiji) or Find Maxima, then get the diffusion coefficient from the MSD: MSD = 4Dt in 2D, with a worked example. - [Porosity and pore size from SEM images in ImageJ (AAO, membranes, coatings)](https://www.labcanvas.com/blog/porosity-pore-size-sem-image) ([Markdown](https://www.labcanvas.com/blog/porosity-pore-size-sem-image.md), updated 2026-11-06): Porosity and pore size from an SEM image in ImageJ: threshold the pores, read %Area as porosity, then Analyze Particles for pore areas and diameters. - [Use ImageJ from Python with PyImageJ (a gentle start)](https://www.labcanvas.com/blog/pyimagej-python) ([Markdown](https://www.labcanvas.com/blog/pyimagej-python.md), updated 2026-11-06): Install PyImageJ, start ImageJ from Python with imagej.init, run your ImageJ macro, and get the image as NumPy and the Results table as pandas. - [Rolling-ball background subtraction in ImageJ: how to choose the radius](https://www.labcanvas.com/blog/rolling-ball-background-subtraction) ([Markdown](https://www.labcanvas.com/blog/rolling-ball-background-subtraction.md), updated 2026-11-06): Subtract background in ImageJ: Process › Subtract Background, a rolling ball radius at least the largest object's, Light background off for fluorescence. - [Wound healing (scratch) assay analysis in ImageJ: % closure step by step](https://www.labcanvas.com/blog/scratch-wound-healing-assay-analysis) ([Markdown](https://www.labcanvas.com/blog/scratch-wound-healing-assay-analysis.md), updated 2026-11-06): Measure a scratch wound in ImageJ: variance filter, threshold and Analyze Particles per frame, then % closure and closure rate, with a worked example. - [Sholl analysis in ImageJ/Fiji and online (step by step)](https://www.labcanvas.com/blog/sholl-analysis) ([Markdown](https://www.labcanvas.com/blog/sholl-analysis.md), updated 2026-11-06): Sholl analysis step by step: circles around the cell body, crossings per radius, the Sholl plot, critical radius and ramification index, in Fiji (SNT) or with an ImageJ macro. - [Tube formation assay quantification in ImageJ (and the Angiogenesis Analyzer)](https://www.labcanvas.com/blog/tube-formation-assay-quantification) ([Markdown](https://www.labcanvas.com/blog/tube-formation-assay-quantification.md), updated 2026-11-06): Quantify a tube formation assay in ImageJ step by step: total tube length, junctions, segments and meshes, plus the Angiogenesis Analyzer and AngioTool. - [Watershed in ImageJ: separate touching particles (and when not to)](https://www.labcanvas.com/blog/watershed-touching-particles) ([Markdown](https://www.labcanvas.com/blog/watershed-touching-particles.md), updated 2026-11-06): Split touching nuclei and nanoparticles with Process › Binary › Watershed in ImageJ, with before and after counts, and why it cuts nanorods to pieces. ## FAQ - **What is LabCanvas?** LabCanvas is a browser-based workspace for scientific visuals. It combines a vector figure editor, a presentation maker, a research poster designer, a 3D studio, a protein structure viewer and a graphing and statistics app, with journal-ready export and an AI assistant. - **How much does LabCanvas cost?** Every app is free to use with an account, with up to 3 designs; downloading and exporting are part of LabCanvas Pro, paid monthly or yearly (see the pricing page for the price in your country). LabCanvas Pro also gives unlimited designs and a monthly allowance of AI credits for the assistant. Choose monthly or yearly and pay securely through Dodo Payments; cancel any time. The website and the free tools at /tools need no account and no payment. - **Where are my designs stored?** In your browser’s storage (IndexedDB) on your own device, and, with cloud saving on (the default for new designs), in your own private folder in LabCanvas cloud, so they open on any computer. You can switch cloud saving off for any design, and File › Save a copy keeps a portable .labcanvas file. - **Can several people edit a design at the same time?** Yes. Share a figure, presentation or poster from its Share button, by a link or with people by e-mail, as view, comment or edit. Everyone who has it open sees the others’ changes as they are made, with their pointers and what they have selected, and the design saves itself a few seconds after the last change. It works on the free plan too. - **Which export formats and resolutions are supported?** PNG, JPEG, WebP, TIFF, PDF and SVG. You set the physical width in millimetres and the resolution (for example 300, 600 or 1200 dpi); PNG and TIFF files record their DPI. Presentations export as one vector PDF. - **Can I make a conference poster?** Yes. LabCanvas Research Poster starts from a template (A0 or A1 portrait, 48 × 36 in landscape, a billboard-style #betterposter layout and more) built from blocks: title, sections, figures, a key finding, a big number, references and a QR code. Drag a block to another column or between two others and the columns re-stack; resize it and the text re-flows. Themes restyle every block at once, and the poster exports as a vector PDF at its exact printed size. - **Can I write LaTeX equations?** Yes. Objects › Equation typesets LaTeX, including AMS environments and chemistry with \ce{…}, into vector outlines that stay sharp in PDF and SVG. Double-click an equation to edit its LaTeX later. - **How do I visualise a protein from the PDB?** Open the Protein viewer, enter a PDB ID such as 1CRN or 4HHB, pick a style (cartoon, surface, ball-and-stick…) and a colouring, select residues on the sequence bar to highlight or restyle them, then download a PNG or add it to your figure. - **Which AI models can the assistant use?** The assistant runs on leading models such as Anthropic Claude, chosen and set up by LabCanvas: there is no API key to paste. Each LabCanvas Pro plan includes monthly AI credits; you can attach images and PDFs to your messages, and your chats are saved to your account. The assistant edits through the same actions as the toolbar, so every change can be undone. - **What is the LabCanvas MCP server?** LabCanvas includes a Model Context Protocol (MCP) server with 97 tools, so AI agents such as Claude Desktop or Claude Code can create and edit figures, slides, posters, graphs, 3D scenes and optical setups in your open LabCanvas apps. - **Can I install LabCanvas as an app?** Yes. The figure editor, Slides, the 3D Studio, the Protein viewer and the Graph app can each be installed from the browser and opened like desktop apps. ## Optional - [Full text of the site for language models](https://www.labcanvas.com/llms-full.txt) - [Every page as Markdown](https://www.labcanvas.com/api/md/_catalog): each page's address with .md added (the home page is https://www.labcanvas.com/index.md) - [Usage policy for AI systems](https://www.labcanvas.com/ai.txt) - [Blog RSS feed](https://www.labcanvas.com/blog/feed.xml) - [Sitemap](https://www.labcanvas.com/sitemap.xml)